Abstract
Foot-and-mouth disease (FMD) is an extremely contagious viral disease affects all cloven- hoofed animals. The present study aimed to investigate the epidemiological situation of FMD in Egypt during 2017 and 2018, based on antigenic and genetic characterizations of FMD virus (FMDV). Thirty oral epithelia were collected from vaccinated animals (14 native cattle and 16 water buffaloes) showed clinical signs of FMD in four Egyptian governorates having outbreaks. In all collected samples the antigen detection was performed using enzyme-linked immunosorbent assay (ELISA), while the genetic characterization was done by using conventional reverse transcription polymerase chain reaction (RT-PCR), Sequencing and phylogenetic analysis were constructed for genetic characterization. The obtained results of FMDV antigen detection ELISA indicated that 50% of the examined samples were positive for FMDV and serotyped as serotype O 40%, serotype SAT2 33% and serotype A 27% respectively. RT-PCR confirmed the results of FMDV antigen detection by ELISA. Six amplicons were sequenced and phylogenetically analyzed for viral protein 1 (VP1) of FMD. Results demonstrated that genotype O was related to East Africa-3 (EA-3) topotype with 12.7% difference from vaccine strain O-IRN-8-2005-Pan-Asia-2. Furthermore, genotype A clustered into Asia topotype with 6% difference from vaccine strain A-IRN-1-2005. Meanwhile genotype SAT2 in 2018 was related to VII topotype but it was in close relation with strains isolated from Libya in 2012 with 94.3% amino acid identity that differ from the previously circulated SAT2 since 2012 and recorded recently in Egypt. The presented results confirmed the circulation of a new topotype of serotype SAT2.
Main Subjects
Highlights
1- The current epidemiological situation of FMD in Egypt, based on antigenic and genetic characterizations of FMDV.
2- Genotype O is related to East Africa-3 (EA-3) topotype with 12.7% difference from vaccine strain O-IRN-8-2005-Pan-Asia-2.
3- Genotype A is clustered into Asia topotype with 6% difference from vaccine strain A-IRN-1-2005.
Full Text
Molecular and serological typing of foot-and-mouth disease virus serotypes currently circulating in Egypt
M.M. Abd El-Rhman1, S.A. Salem2, A.I. Bazid3 and D.G. Abo El-Hassan4
1Department of Preventive Medicine, General Organization for Vet Services, 2Department of Virology, Animal Health Research Institute, 3Department of Virology, Faculty of Vet Medicine, University of Sadat city, 4Department of Medicine and Infectious Diseases, Faculty of Vet Medicine, Cairo University, Giza, Egypt
dieaabo@cu.edu.eg, 0000-0002-9406-6865, Corresponding author
mariammagdy_85@yahoo.com, 0000-0002-1309-4742
sayedsalem60@yahoo.com, 0000-0002-5790-4727
abdelhameed.mousa@vet.usc.edu.eg, 0000-0002-0994-1865
2020-06-16
2020-08-30
Abstract
Foot-and-mouth disease (FMD) is an extremely contagious viral disease affects all cloven- hoofed animals. The present study aimed to investigate the epidemiological situation of FMD in Egypt during 2017 and 2018, based on antigenic and genetic characterizations of FMD virus (FMDV). Thirty oral epithelia were collected from vaccinated animals (14 native cattle and 16 water buffaloes) showed clinical signs of FMD in four Egyptian governorates having outbreaks. In all collected samples the antigen detection was performed using enzyme-linked immunosorbent assay (ELISA), while the genetic characterization was done by using conventional reverse transcription polymerase chain reaction (RT-PCR), Sequencing and phylogenetic analysis were constructed for genetic characterization. The obtained results of FMDV antigen detection ELISA indicated that 50% of the examined samples were positive for FMDV and serotyped as serotype O 40%, serotype SAT2 33% and serotype A 27% respectively. RT-PCR confirmed the results of FMDV antigen detection by ELISA. Six amplicons were sequenced and phylogenetically analyzed for viral protein 1 (VP1) of FMD. Results demonstrated that genotype O was related to East Africa-3 (EA-3) topotype with 12.7% difference from vaccine strain O-IRN-8-2005-Pan-Asia-2. Furthermore, genotype A clustered into Asia topotype with 6% difference from vaccine strain A-IRN-1-2005. Meanwhile genotype SAT2 in 2018 was related to VII topotype but it was in close relation with strains isolated from Libya in 2012 with 94.3% amino acid identity that differ from the previously circulated SAT2 since 2012 and recorded recently in Egypt. The presented results confirmed the circulation of a new topotype of serotype SAT2.
Keywords: FMDV, Cattle, Buffalo, ELISA, RT-PCR
التنمیط الجزیئی والمصلی للأنماط المصلیة لفیروس الحمى القلاعیة المنتشرة حالیا فی مصر
مریم مجدی عبد الرحمن1، سید أحمد حسن سالم2، عبد الحمید إسماعیل بازید3، ضیاء جمال الدین أبوالحسن4
1قسم الطب الوقائی، الهیئة العامة للخدمات البیطریة، 2قسم الفیروسات، معهد صحة الحیوان، الدقی، 3قسم الفیروسات، کلیة الطب البیطری، جامعة مدینة السادات، 4قسم الأمراض الباطنة والمعدیة، کلیة الطب البیطری، جامعة القاهرة، الجیزة، مصر
الخلاصة
مرض الحمى القلاعیة هو مرض فیروسی شدید العدوى یصیب الحیوانات ذات الظلف المشقوق. تستهدف الدراسة الحالیة تحدید الوضع الوبائی لمرض الحمى القلاعیة فی مصر خلال عامی 2017 و 2018، بناءً على الخصائص المستضدیة والجینیة لفیروس الحمى القلاعیة. تم جمع ثلاثین ظهارة من فم حیوانات (أبقار وجاموس) محصنة باللقاح الواقی، تبدی علامات سریریة لمرض الحمى القلاعیة فی أربع محافظات مصریة مصابة بفاشیات المرض. تم إجراء الکشف عن مولد الضد للفیروس فی العینات التی تم جمعها باستخدام اختبار الفحص المناعی المرتبط بالإنزیم، بینما تم إجراء التوصیف الجینی باستخدام التفاعل العکسی لسلسلة تفاعل البلمرة المتسلسل، کما تم إجراء التسلسل والتحلیل النشوئی للتوصیف الجینی. أوضحت النتائج التی تم الحصول علیها أن 50٪ من العینات التی تم فحصها کانت إیجابیة لفیروس الحمى القلاعیة. النمط المصلی (و) یمثل 40% والنمط المصلی (سات 2) یمثل 33%، بینما النمط المصلی (أ) یمثل 27% على التوالی. تم ترتیب تسلسل ستة أمبلیکونات وتحلیلها من الناحیة الوراثیة للبروتین الفیروسی1 لفیروس الحمى القلاعیة. أظهرت النتائج أن النمط المصلی (و) مرتبط بنمط شرق إفریقیا 3 وبفارق 12.7٪ عن سلالة اللقاح و-إیران-8-2005-بان-أسیا-2. وقد ارتبط النمط المصلی (أ) بالنمط الآسیوی مع اختلاف 6٪ عن سلالة اللقاح أ-إیران-1- 2005. فی الوقت نفسه، کان النمط المصلی (سات 2) فی عام 2018 مرتبطًا بالنمط المصلی السابع المعزول من لیبیا فی عام 2012 مع هویة حمض أمینی 94.3 ٪ ویختلف عن النمط المصلی (سات 2) المتداول منذ عام 2012 وقد تم تسجیله مؤخراً فی مصر وأکدت نتائج الدراسة وجوده.
Introduction
Foot-and-mouth disease (FMD) is the most important transboundary animal disease, distributed globally and recorded in domestic and wild animals with cloven hoofs; it affects severely the productivity of livestock, causing great economic losses. Clinical signs of FMD include fever, loss of appetite, lameness and vesicular lesions of the feet, tongue and teats; with mortality rate usually high in calves. A substantial proportion of recovered animals become carriers and the important route of FMD virus infection is through aerosol transmission, with the initial viral replication and persistence occurring in the naso-pharynx (1). It has been documented that the virus is an Apthovirus of Picornaviridae family with RNA genome about 8.5 kb that transcribes to 12 protein-coding genes and one viral genome linked protein and have seven serotypes (O, A, C, South African Territories (SAT) 1, SAT2, SAT3, and Asia1) can be identified serologically, based on complete absence of cross-protection between them or sometimes to the variants within the same serotype (1).
The epidemiological information of FMD in Egypt revealed that FMD is endemic and outbreaks of FMDV serotypes O, A and SAT2 have been recorded at all Egyptian governorates (2). Historical background of FMD in Egypt started since 1950 when outbreak of serotype SAT2 was recorded. Despite of disappearance of serotype SAT2, it reinvaded several governorates in the country in 2012, after 62 years of absence causing massive losses among infected animals (3). The number of topotypes that related to serotype SAT2 is fourteen toptype, the Egyptian serotype SAT2 is clustered in topotype VII (4); recently, phylogenetic analysis showed emerging new strain of SAT2 in Egypt in close relation with that isolated from Libya in 2012 and it was responsible for devastating outbreaks in 2018 (5). While serotype O is the predominant in circulation since it was reported in 1951, many topotypes were appeared as the topotype of Middle East-South Asian (ME-SA) and East Africa-3 (EA-3) in Egypt (6). Topotype EA-3 emerged in 2012 and is still spreading in Egypt (7,8). Minor outbreaks related to FMDV serotype A started to appear in Egypt since 1953 but at the beginning of 2006, severe FMDV outbreak of serotype A causing severe economic losses has been reported; this could be related to the importation of live animals from African countries (9). During the last 11 years, two topotypes of serotype A were identified in Egypt as Asian and African topotypes (10). The effective control measures of FMD are depending on vaccination, accurate diagnosis, implantation of a strict bio-security measures and regular monitoring of immunity induced by good quality vaccines (1). Accurate diagnosis of FMDV depends on the clinical signs in combination with laboratory diagnostic tests (11,12). Reverse transcription polymerase chain reaction (RT-PCR) is a major diagnostic tool of FMDV detection and it is characterized by high sensitivity and specificity (13,14). Sequencing of viral gene expressing viral protein1 (VP1) and construction of phylogenetic tree have been used to investigate the molecular epidemiology of FMDV and tracing the source of newly emerging strains (1).
Lately, many FMD outbreaks have been recorded in Egyptian governorates. Therefore, this study aimed to describe the molecular and genetic characterization of the recently circulating strains of FMDV in 2017 and 2018 and to evaluate the immunogenic relation between the strains used in the vaccine and circulating strains in the field.
Materials and methods
Study area and period of study
Four Egyptian governorates (Qalyobia, Sharqia, Menofia and Alexandria) were included in the study during the period between September 2017 and May 2018.
Animals and samples
A total of thirty oral epithelium samples were collected from clinically examined adult vaccinated 14 native cattle and 16 water buffaloes showed clinical signs suspected to be FMD. The samples were collected and transported according to OIE (15) then delivered to the Animal Health Research Institute (AHRI). The collected samples were maintained at -70°C to be used in FMDV antigen detection ELISA test and RT-PCR technique (9,2).Cattle and buffalo were vaccinated by Vet authorities using oil-adjuvant trivalent vaccine containing O-IRN-8-2005-Pan-Asia-2, A-IRN-1-2005, and EGY/H1Ghb/2012 of FMDV serotypes O, A and SAT2 respectively produced by Vet Serum and Vaccine Research Institute (VSVRI), Cairo, Egypt.
FMDV antigen detection ELISA
Enzyme-linked immunosorbent assay was used to detect FMDV antigen and its serotypes in the collected epithelium samples by using FMDV antigen detection ELISA serotyping of FMDV O, A, and SAT2 (KIT). IZSLER: Brescia, Italy (IAH: Pirbright, UK, Lot No: 01-2011 1204269). The results were calculated according to the manufacturer’s test guidelines. Samples with optical density (OD) < 0.1 were considered negative for FMDV while samples OD ≥ 0.1 were considered positive for FMDV O, A and SAT2 based on the catching type specific monoclonal antibodies (MAbs).
RT-PCR for molecular characterization of FMDV
Table 1: Serotype specific primers for detection of FMDV by RT-PCR
Serotype |
Primer Name |
Oligonucleotide sequence (5`-3`) |
Product size (bp) |
Reference |
O |
FMDV-O-EA-F |
CCTCCTTCAAYTACGGTG |
283 |
(16) |
NK61-R |
GACATGTCCTCCTGCATCTG |
|||
A |
FMD-A-Egy-F |
GGAATCWGCAGACCCTGTC |
750 |
(17) |
NK61-R |
GACATGTCCTCCTGCATCTG |
|||
SAT2 |
1D209F |
CCACATACTACTTTTGTGACCTGA |
715 |
(18) |
2B208R |
ACAGCGGCCATGCACGACAG |
Sequencing and phylogenetic analysis of the amplified VP1 gene of FMDV
The six amplicons of RT-PCR were used for the sequencing of VP1 gene of FMDV. The detected DNA bands were purified using QIAquick Gel Extraction Kit according to manufacturer protocol. Then, the samples were sent for sequencing in Animal Research Institute, Genome Research Unit. The results of VP1 sequences were used for alignment with other representative FMD VP1 sequences from GenBank, the vaccine strains were also included in the analysis. The phylogenetic analysis was performed by using BioEdit program version 5.0.9. These alignments were used to construct the phylogenetic tree by using program MEGA version 6.0.1 (19). The reliability of the tree topology was estimated with performing 1000 bootstrap replicates as implemented in the program.
Results
FMDV antigen detection by ELISA
Testing 30 oral epithelium samples showed positive results for detection of FMDV antigen serotypes O, A, SAT2 and SAT1 using ELISA kit (Table 2). The results revealed in cattle, 9 samples out of 14 (64.3%) were positive and serotyped as O and A in percentages of 55.5 and 44.5% respectively with absence of serotype SAT2, while in buffaloes 6 samples out of 16 (37.5%) were positive and serotyped as O and SAT2 in percentages of 16.7 and 83.3% respectively with absence of serotype A. Totally, 15 samples out of 30 (50%) were positive for detection of FMDV antigen and serotyped as O, A and SAT2 with incidence percent of 40, 27 and 33% respectively. In the selected governorates, serotypes O, A and SAT2 were detected in Qalyobia and Sharqia governorates. In Qalyobia, serotype O was the most predominant one with incidence percent of 71.4% while serotypes A and SAT2 showed same incidence percent of 14.3%. In Sharqia, serotypes O, A and SAT2 showed same incidence level with percent of 33.3%. On the other hand, serotypes A and SAT2 were detected in Menofia and Alexandria. The incidence of both serotypes in Menofia with same level in percent of 50% while in Alexandria serotype SAT2 was higher than serotype A with percents of 66.7% and 33.3% respectively. Totally, the highest positivity of FMDV antigen detection was detected in Qalyobia (70%) followed by Menofia (43%), Sharqia (40%) and Alexandria (38%) respectively (Table 2).
Table 2: Detection and serotyping of FMDV antigen using ELISA in cattle and buffaloes in four Egyptian governorates
Animal |
Governorate |
Examined Samples No. |
Positive FMDV Ag [No. (%)] |
Serotypes [No. (%)] |
||
O |
A |
SAT2 |
||||
Cattle |
Qalyobia |
6 |
5 (83.3) |
4 (80) |
1 (20) |
0 |
Sharqia |
3 |
2(66.7) |
1(50) |
1(50) |
0 |
|
Menofia |
3 |
1(33.3) |
0 |
1(100) |
0 |
|
Alexandria |
2 |
1(50) |
0 |
1(100) |
0 |
|
Total |
14 |
9(64.3) |
5(55.5) |
4(44.5) |
0 |
|
Buffaloes |
Qalyobia |
4 |
2(50) |
1(50) |
0 |
1(50) |
Sharqia |
4 |
1(25) |
0 |
0 |
1(100) |
|
Menofia |
2 |
1(50) |
0 |
0 |
1(100) |
|
Alexandria |
6 |
2(33.3) |
0 |
0 |
2(33.3) |
|
Total |
16 |
6(37.5) |
1(16.7) |
0 |
5(83.3) |
|
Cattle, Buffaloes |
Qalyobia |
10 |
7(70) |
5 (71.4) |
1(14.3) |
1(14.3) |
Sharqia |
7 |
3(42.9) |
1(33.3) |
1(33.3) |
1(33.3) |
|
Menofia |
5 |
2(40) |
0 |
1(50) |
1(50) |
|
Alexandria |
8 |
3(37.5) |
0 |
1(33.3) |
2(66.7) |
|
Total |
30 |
15(50) |
6(40) |
4(27) |
5(33) |
RT-PCR for molecular detection of FMDV
RT-PCR using genotype specific primers for molecular detection and genotyping of FMDV serotypes O, A, and SAT2 performed on the 15 positive samples to FMDV by antigen detection ELISA. Results of conventional RT-PCR were typical to positive results of FMDV antigen detection ELISA as shown in Table 2. Molecular weight of FMDV genotype O was detected using conventional RT-PCR at 283 base pair (bp), whereas those of genotypes A and SAT2 were at 750 and 715bp respectively (Figure 1).
Figure 1: Agarose gel electrophoresis of amplified VP1 gene of serotypes O, A and SAT2 with product size of 283 bp,750 bp and 715 bp, respectively. compared to positive control sample. M: Molecular weight marker (ladder).
Nucleotide Sequencing
Six samples representative to FMDV serotypes O, A and SAT2 as shown in Table 3 were sequenced, phylogenetically analyzed and compared with the representative FMDV sequences available in GenBank.
Table 3: Details of genotypes, province, accession numbers and characterization of the strains
FMD Genotype |
Province |
Accession # |
Strain description (Name /P/EGY/Year) |
O |
Qalyobia |
MT199286 |
FMDV O/Qalyobia1/EGY/2017 |
O |
Qalyobia |
MT199287 |
FMDV O/Qalyobia2/EGY/2017 |
O |
Qalyobia |
MT199288 |
FMDV O/Qalyobia3/EGY/2017 |
A |
Sharqia |
MT199284 |
FMDV A/El-Sharqia/EGY/2018 |
A |
Alexandria |
MT199285 |
FMDV A/Alexandria/EGY/2018 |
SAT2 |
Menofia |
MT199283 |
FMDV SAT2/El Menofia/EGY/2018 |
Phylogenetic analysis of FMDV serotype O
Phylogenetic tree of the VP1 sequencing results of three strains of FMDV serotype O (O/Qalyobia1/EGY/2017, O/Qalyobia2/EGY/2017 and O/Qalyobia3/EGY/2017) showed that its belonging to topotype EA-3 which detected in Egypt recently, strains are closely related to each other with 100% amino acid identity and closely related to SUD/8/2008 Accession #GU566063 with 92.7% amino acid identity. The characterized strains differ from Egyptian vaccine strain (O-IRN-8-2005-Pan-Asia-2) within ME-SA topotype with 12.7% (Figures 2,3).
Figure 2: Phylogenetic tree of the VP1 sequence of FMDV serotype O isolated from Egypt. The FMDV serotype O strains of this study are in bold font labeled with red circles and the Vaccine Strain is in bold font labeled with blue square.
Figure 3: The identity and divergence between the Egyptian strains of FMDV serotype O of this study and the vaccine strains and other O reference strains.
Phylogenetic analysis of FMDV serotype A
Phylogenetic tree of the VP1 sequencing results of two strains of FMDV serotype A (A/Sharqia/EGY/2018 and A/Alexandria/EGY/2018 showed that its belonging to A-Iran-05 lineage of Asian topotype indicating clear difference from A/EGY/1/72 (accession number #EF208756) and A/EGY/1/2006 (accession number #KF112902) with 79.8 and 78.8% amino acid identity respectively as they related to Africa topotype, which were circulated and responsible for outbreaks during 2006 and 2009. Clustering of the two characterized strains were in the same group of the vaccine strain (A-IRN-1-2005 Accession #KF208769) with 94.4 and 93.8% amino acid identity respectively (Figures 4,5).
Figure 4: Phylogenetic tree of the VP1 sequence of FMDV serotype A isolated from Egypt. The FMDV serotype A strains of this study are in bold font labeled with red circles and the Vaccine Strain is in bold font labeled with blue square.
Figure 5: The identity and divergence between the Egyptian strains FMDV serotype A of this study, the vaccine strains and other serotype A reference strains.
Phylogenetic analysis of FMDV serotype SAT2
Phylogenetic tree of the VP1 sequencing results of one strain of FMDV serotype SAT2 (SAT2/Menofia/EGY/2018) revealed clustering the characterized strain in topotype VII, lineages Lib-12 that not detected before and differs from the previously circulated SAT2 in Egypt (SAT2/Gharbia/Egy/2012 and SAT2/Alex/Egy/2012) since 2012. In addition, the newly emerged strain was genetically closely related to Lib-12 lineage (LIB/39/2012-Lib-12 #JX570633) with 94.3% amino acid identity and differ from vaccine strain EGY/H1Ghb/2012 #KF055860 by 12.3% (Figures 6,7).
Figure 6: Phylogenetic tree of the VP1 sequence of FMDV serotype SAT2 isolated from Egypt. The FMDV serotype SAT2 strain of this study are in bold font labeled with red circle and the Vaccine Strain is in bold font labeled with blue square.
Figure 7: The identity and divergence between the Egyptian strains FMDV serotype A of this study, the vaccine strains and other serotype A reference strains.
Discussion
In Egypt, FMD is in endemic form and several outbreaks had been occurred with serotypes O, A and SAT2 since long time; control of FMD in Egypt is carried out by using inactivated trivalent vaccine locally produced containing O-IRN-8-2005-Pan-Asia-2, A-IRN-1-2005, and EGY/H1Ghb/2012 of FMDV serotypes O, A and SAT2 as well as implementation of biosecurity measures (9).
Detection of FMDV antigen in oral epithelium samples of vaccinated cattle and buffaloes at several hot focuses in several governorates, represent a potential hazard of disease remaining endemic despite vaccination. There are various risk factors that have been determined to be responsible for FMD incidence in the vaccinated areas (2). Failure to vaccinate, disrupted herd immunity, health status of animals, FMDV carrier status, lack of vaccine matching with field isolates, large population and species interface consider some challenges in FMDV vaccination; additionally, animal markets are providing an ideal situation for FMDV spread where animals are collected from different areas and stayed in one place without improper vaccine history or unclear health status (1). Such reasons consider a risk for rapid transmission of FMDV, also can lead to vaccine failure. The obtained serotyping results of FMDV in cattle and buffaloes were nearly similar with Diab et al. (2) they reported FMDV antigen serotypes O, and A in cattle during 2013 and 2014. On the other hand, the high resistance of buffalo to FMDV came in agreement with Elhaig and Elsheery (3) they demonstrated that buffaloes are resistant to clinical FMD, serotypes O and A, and most naturally infected buffaloes do not develop obvious clinical signs unlike cattle; additionally, they reported that buffaloes appeared to be more susceptible to be infected with FMDV genotypes of SAT2 than cattle.
For recall, FMDV antigen of genotypes O, A and SAT2 was detected in Qalyobia and Sharqia governorates. Totally, Qalyobia was the highest governorate in incidence with percent of 70% followed by Menofia 43%, Sharqia 40% and Alexandria 38%. The results coincide with Ahmed et al. (4) who reported that Delta Governorates characterized by its high density of animal population, so early struck of infection firstly was recorded in Delta region as in the new outbreak of FMDV genotype SAT2. The total incidence of FMDV serotypes showed that genotype O 40% was the predominant one followed by genotype SAT2 33% then genotype A 27%. These results agree with the previous Egyptian studies which showed that FMDV serotypes in Egypt were identified (O, A, and SAT2) in field samples during 2016-2017; genotype O had the majority in incidence with percent of 78.9% while the incidence of genotypes SAT2 and A was 15.7% and 5.3% respectively (8). Predominant circulation of serotype O, SAT2 and A was also reported during 2015-2016 in Egypt with incidence of 51.8%, 18.5% and 9.2% respectively (6). In 2015-2016, the results of FMDV outbreak indicated that serotype O was the most prevalent one of the seven known serotypes of FMDV as well as it was the most distributed in many parts of the world (10). Genotyping of Field FMD suspected samples, received by the World-FMD-Reference-Laboratory (WRLFMD) from cattle and water buffalo in various locations of Egypt during the midyear 2014, revealed that FMD type O belong to the EA-3 topotype, FMD type A belong to the AFRICA topotype, G-IV lineage and ASIA topotype, Iran-05BAR-08 lineage. While FMD type SAT 2 belong to topotype VII, Ghb-12 lineage and Alx-12 lineage. FMDV serotypes O and A were the predominant strains circulating in Egypt followed by serotype SAT2 (20). Diab et al. (2) mentioned that serotype O was the predominant serotype followed by serotype A then serotype SAT2 during 2013- 2014 in Egypt. In contrast, WRLFMD (21) in its epidemiological report of FMD in Egypt about field samples, collected between January 2017 and November 2018 reported predominance of FMD type SAT2, followed by serotype O then serotype A. Genotyping showed that type O belong to topotype EA- 3, type A belong to topotype AFRICA/G-IV and type SAT2 belong to topotype VII (lineage Ghb-12 and lineage Lib-12) using real-time RT-PCR technique. These data agree with our results of predominance of FMDV types O and SAT2 among cattle and Buffaloes respectively.
FMDV by nature of it is RNA genome is characterized by high mutation rate, the mutation could be used by the virus for emerging of a wide range of genotypes within each serotype with no or minimal cross-protection between serotypes or even genotypes. Circulating of multiple strains differ from field strains can result in vaccination failure (22). The high antigenic variation of FMDV can help in understanding the reason in persistent occurrence of FMDV outbreaks in Egypt even with obligatory vaccination that implemented by Vet authorities (7). Hence, molecular and genetic characterization of circulating FMDV strains are urgently needed to ensure the efficacy of vaccination and the applied control measures (23).
Viral protein 1 (VP1) coding region of FMDV strains is immunogenically significant and responsible for antigenic heterogeneity, protective immunity, serotype specificity and cell virus attachment, its nucleotide sequences based phylogenetic analyses have been used widely to deduce evolutionary dynamics, genetic characterization and epidemiological relationships among the genetic lineages of outbreak strains (24). The VP1 sequencing results of three strains of FMDV serotype O/Qalyobia1/EGY/2017, O/Qalyobia2/EGY/2017 and O/Qalyobia3/EGY/2017 demonstrated its belonging to topotype EA-3 which detected in Egypt recently, the strains were closely related to each other with 100% amino acid identity and were closely related to SUD/8/2008 (Accession#GU566063) with 92.7% amino acid identity. The characterized strains differ from Egyptian vaccine strain (O-IRN-8-2005-Pan-Asia-2) within ME-SA topotype with 12.7%. Our results supported by the recent published report describing the circulation of genotype O, topotype EA-3 in Egypt during 2015-2016 (6). EA-3 topotype of genotype O was predominant in Egypt from 2013 onwards (7,8). The sequence of isolates of genotype O (EA-3 topotype) in 2013-2014 was in close relation with O/SUD/8/2008 with 93% amino acid identity while the difference from vaccine strain O-IRN-8-2005-Pan-Asia-2 of ME-SA topotype is 14.6% (2).
The VP1 sequencing results of two strains of FMDV genotype A (A/Sharqia/EGY/2018 and A/Alexandria/EGY/2018) indicated its belonging to A-Iran-05 lineage of Asia topotype indicating clear difference from A/EGY/1/72 (accession number #EF208756) and A/EGY/1/2006 (accession number #KF112902) with 79.8% and 78.8% amino acid identity respectively as they related to Africa topotype, circulated in the previous, and were responsible for outbreaks during 2006 and 2009 Clustering of the characterized strains were in the same group of the vaccine strain (A-IRN-1-2005 Accession #KF208769) with 94.4% and 93.8% amino acid identity respectively. Many reports revealed that serotype A (Asia topotype) was circulating during the last 11 years (10). Genotype A was closely related to recent Egyptian isolates and vaccine strain with identity 96.4% in Egypt during 2013and 2014 (2). A part from that, genotype IV of serotype A (Africa topotype) was detected in 2016 and 2017 (8).
The diversity in SAT genotypes of FMDV is very high, mostly detected in SAT2 (25). Egyptian SAT2 VII/ALEX/Egy and VII/GHB/Egy were related to lineage 2 of topotype VII (4). In 2018, severe outbreaks of FMDV were reported in buffaloes more than in cattle and many farmers complained from it in Egypt (5). This study confirmed circulation of the new exotic lineage of SAT2(serotype SAT2, topotype VII, Lib-12 lineage) that reported for first time in Egypt, where the results showed SAT2/Menofia/EGY/2018 was genetically closely related to Lib-12 lineage (LIB/39/2012-Lib-12 Accession#JX570633) with 94.39% amino acid identity and differ from vaccine strain EGY/H1Ghb/2012 Accession# KF055860 by 12.3% amino acid identity. A lot of FMDV serotypes and its topotypes detected in Egypt, due to importation of live animals from neighboring countries and uncontrolled movement of animals through boarders. Such factors consider a risk factors for introduction of exotic strains to susceptible animals (7). The obtained results were in parallel with Al-Hosary et al. (6) who stated that topotype VII of serotype SAT2 is the only topotype that detected in Egypt as well as it is endemic in south of sub-Saharan African countries. Soltan et al. (5) confirmed a recent Lib-12 lineage of topotype VII serotype SAT2 emerged in Egypt and caused devastating outbreaks in 2018. Hagag et al. (25) recorded a newly emerged strain in 2018 was closely related to strains isolated from Libya in 2012 (Topotype VII, lineage 3), with 94.3% amino acid identity and was clearly separated from SAT2/GVII/Gharbia/Egy/2012 and SAT2/GVII/Alex/Egy/2012 (Topotype VII, lineage 12), indicating a new introduction of FMDV serotype SAT2 in Egypt.
Conclusion
Continuous monitoring of immunogenic relation between the circulating strains in the field and FMDV vaccine strains is needed to be sure from achieving of maximum protection of the vaccine under the field condition. The results confirmed the circulation of a new topotype of serotype SAT2 as a new emerged strain. Uncontrolled movement of live animals along borders, illegal trade and importation from endemic countries with FMD make Egypt susceptible for incursion of sick or carrier animals. Monitoring the activity of FMDV in neighboring countries is essential to predict strains that might escape to Egypt.
Acknowledgments
This work has been done in the Virology Laboratory, Animal Health Research Institute, Dokki, Giza, Egypt, and the field data kindly provided by the Preventive Medicine Department, General Organization of Vet Services, Dokki, Giza, Egypt. The authors are grateful to the authorities for providing facilities. The authors did not receive any fund for this study.
Conflict of interests
The authors declare that they have no competing interests.