Journal of Molecular Biology
Synthetic oligonucleotide probes deduced from amino acid sequence data: Theoretical and practical considerations
References (0)
Cited by (560)
Increased power generation from a new sandwich-type microbial fuel cell (ST-MFC) with a membrane-aerated cathode
2020, Biomass and BioenergyCitation Excerpt :Univ1392 (Bacteria, ACGGGCGGTGTGTAC) [33] and Arc915 (Archaea, GTGCTCCCCCGCCAATTCCT) [34] oligonucleotide probes were used to detect the whole bacteria and archaea. The samples were spotted and dried, and the following steps were carried out according to the procedure described in the previous reports [35–37]. FISH analysis and the viability of the biofilm samples (bacterial viability kit, Thermo Fisher Scientific, USA) were examined under fluorescence microscopy (Nikon, Eclipse Ni–U microscope, Japan) equipped with an image analysis system (Nis-Elements Analysis software).
Efficiency of fluorescence in situ hybridization (FISH) method for the rapid detection of Salmonella in minced lamb meat: Method analysis and optimization
2020, Journal of Microbiological MethodsSpatial and temporal changes in microbial diversity of the Marmara Sea Sediments
2011, Marine Pollution BulletinCitation Excerpt :After prehybridization, probe at a final concentration of 5 ng μl−1 was added into the hybridization buffer and incubated at the optimal hybridization temperature for 3 h. Following hybridization, 2 μl of 4′,6-diamidino-2-phenylindole (DAPI) DNA stain (final concentration of 3.3 μg/ml) was added into the hybridization buffer and incubated at room temperature for 10 min. The cells were washed twice in wash buffer containing 20 mmol l−1 Tris–HCl (pH 7.2), 0.01% SDS, 5 mmol l−1 EDTA and between 0.9 mol l−1 and 56 mmol l−1 NaCl according to the formula of Lathe (1985) for 15 min at the optimal washing temperature before a final wash with deionized water. Slides were air dried and one drop of Citifluor antifadent (Citifluor Ltd., UK) was added to the sample.
Comparison of T cell immune responses induced by vectored HIV vaccines in non-human primates and humans
2010, VaccineCitation Excerpt :The open reading frames encode Gag from CAM-1, Pol (including only the reverse transcriptase and integrase gene products) from IIIB, and Nef from JRFL strains [21]. Gene sequences were codon optimized to enhance expression in mammalian cells [22]. The pol transgene segment was inactivated by substituting alanine codons for amino acids at enzymatically active sites [23–29] and the nef transgene segment was inactivated through substitutions, which prevent attachment to the cytoplasmic membrane and retrotrafficking into endosomes [30].
Comparative analysis of immune responses induced by vaccination with SIV antigens by recombinant Ad5 vector or plasmid DNA in rhesus macaques
2010, Molecular TherapyCitation Excerpt :Five animals were immunized with recombinant Ad5 vectors encoding SIVmac239gag, SIVmac239nef, and SIVmac239pol. Genes coding for Gag, Pol, and Nef were synthesized based on codons frequently used in mammalian cells.31 All genes were based on reported sequences from SIVmac239 with the exception of Nef that was based on the sequence reported for SIVmac251 (ref. 32).