Synthetic oligonucleotide probes deduced from amino acid sequence data: Theoretical and practical considerations

doi:10.1016/0022-2836(85)90276-1

Journal of Molecular Biology

Volume 183, Issue 1, 5 May 1985, Pages 1-12

https://doi.org/10.1016/0022-2836(85)90276-1 Get rights and content

Abstract

Synthetic probes deduced from amino acid sequence data are widely used to detect cognate coding sequences in libraries of cloned DNA segments. The redundancy of the genetic code dictates that a choice must be made between (1) a mixture of probes reflecting all codon combinations, and (2) a single longer “optimal” probe. The second strategy is examined in detail. The frequency of sequences matching a given probe by chance alone can be determined and also the frequency of sequences closely resembling the probe and contributing to the hybridization background. Gene banks cannot be treated as random associations of the four nucleotides, and probe sequences deduced from amino acid sequence data occur more often than predicted by chance alone. Probe lengths must be increased to confer the necessary specificity. Examination of hybrids formed between unique homologous probes and their cognate targets reveals that short stretches of perfect homology occurring by chance make a significant contribution to the hybridization background. Statistical methods for improving homology are examined, taking human coding sequences as an example, and considerations of codon utilization and dinucleotide frequencies yield an overall homology of greater than 82%. Recommendations for probe design and hybridization are presented, and the choice between using multiple probes reflecting all codon possibilities and a unique optimal probe is discussed.

References (0)

Cited by (560)

Increased power generation from a new sandwich-type microbial fuel cell (ST-MFC) with a membrane-aerated cathode
2020, Biomass and Bioenergy
Citation Excerpt :
Univ1392 (Bacteria, ACGGGCGGTGTGTAC) [33] and Arc915 (Archaea, GTGCTCCCCCGCCAATTCCT) [34] oligonucleotide probes were used to detect the whole bacteria and archaea. The samples were spotted and dried, and the following steps were carried out according to the procedure described in the previous reports [35–37]. FISH analysis and the viability of the biofilm samples (bacterial viability kit, Thermo Fisher Scientific, USA) were examined under fluorescence microscopy (Nikon, Eclipse Ni–U microscope, Japan) equipped with an image analysis system (Nis-Elements Analysis software).
In this study, a new aeration approach was used for cathode by offering an efficient and cost-effective alternative for practical applications of microbial fuel cells. Therefore, a new sandwich type microbial fuel cell was constructed having three chambers (two anodes and one cathode) was constructed. This sandwich type microbial fuel cell was fed with a mixture of sewage sludge and algae biomass (at the ratio of 1:1). The pure oxygen gas was delivered to the cathode by using hydrophobic hollow fiber gas transfer membranes at different gas pressures (2, 4, 6, 8 and 10 psi). The results revealed that this new sandwich type microbial fuel cell achieved a good performance, and the max power density increased from 1448 mW m⁻² to 26680 mW m⁻² with an increase in oxygen pressure from 2 psi to 10 psi. The presence of electrochemically active bacteria-colonization on the anode's surfaces was revealed by microscopic observations and molecular analysis. This study demonstrated the feasibility of using a hollow fiber gas transfer membrane and a mixture of sewage sludge and algae biomass to enhance power production by sandwich type microbial fuel cell.
Efficiency of fluorescence in situ hybridization (FISH) method for the rapid detection of Salmonella in minced lamb meat: Method analysis and optimization
2020, Journal of Microbiological Methods
Salmonella contamination has been always regarded as one of the main issues in different food products especially fresh meat, while its detection time is normally beyond the shelf life of fresh products. In this paper, a 16S RNA based FISH method was developed for the detection of Salmonella in minced lamb meat. The parameters affecting the method including temperature, probe, salt and formamide concentrations, were optimized for FISH efficiency. Then the method was used to detect Salmonella in culture media and in minced lamb samples at the presence or absence of other pathogenic bacteria. The optimized condition included the probe concentration of 50 micromolar, salt concentration of 0.464 M, formamide concentration of 35%, and temperature of 60 °C. The optimized method could successfully reveal the presence of Salmonella in samples with a complex environment. The study showed that FISH could be a reliable method for the rapid and accurate detection of Salmonella in minced lamb, provided that the method parameters are at their optimal values. This method can be suggested as a convenient, rapid, and reliable method for safety assurance of fresh meat.
A safer, urea-based in situ hybridization method improves detection of gene expression in diverse animal species
2018, Developmental Biology
In situ hybridization is a widely employed technique allowing spatial visualization of gene expression in fixed specimens. It has greatly advanced our understanding of biological processes, including developmental regulation. In situ protocols are today routinely followed in numerous laboratories, and although details might change, they all include a hybridization step, where specific antisense RNA or DNA probes anneal to the target nucleic acid sequence. This step is generally carried out at high temperatures and in a denaturing solution, called hybridization buffer, commonly containing 50% (v/v) formamide – a hazardous chemical. When applied to the soft-bodied hydrozoan medusa Clytia hemisphaerica, we found that this traditional hybridization approach was not fully satisfactory, causing extensive deterioration of morphology and tissue texture which compromised our observation and interpretation of results. We thus tested alternative solutions for in situ detection of gene expression and, inspired by optimized protocols for Northern and Southern blot analysis, we substituted the 50% formamide with an equal volume of 8 M urea solution in the hybridization buffer. Our new protocol not only yielded better morphologies and tissue consistency, but also notably improved the resolution of the signal, allowing more precise localization of gene expression and reducing aspecific staining associated with problematic areas. Given the improved results and reduced manipulation risks, we tested the urea protocol on other metazoans, two brachiopod species (Novocrania anomala and Terebratalia transversa) and the priapulid worm Priapulus caudatus, obtaining a similar reduction of aspecific probe binding. Overall, substitution of formamide by urea during in situ hybridization offers a safer alternative, potentially of widespread use in research, medical and teaching contexts. We encourage other workers to test this approach on their study organisms, and hope that they will also obtain better sample preservation, more precise expression patterns and fewer problems due to aspecific staining, as we report here for Clytia medusae and Novocrania and Terebratalia developing larvae.
Spatial and temporal changes in microbial diversity of the Marmara Sea Sediments
2011, Marine Pollution Bulletin
Citation Excerpt :
After prehybridization, probe at a final concentration of 5 ng μl−1 was added into the hybridization buffer and incubated at the optimal hybridization temperature for 3 h. Following hybridization, 2 μl of 4′,6-diamidino-2-phenylindole (DAPI) DNA stain (final concentration of 3.3 μg/ml) was added into the hybridization buffer and incubated at room temperature for 10 min. The cells were washed twice in wash buffer containing 20 mmol l−1 Tris–HCl (pH 7.2), 0.01% SDS, 5 mmol l−1 EDTA and between 0.9 mol l−1 and 56 mmol l−1 NaCl according to the formula of Lathe (1985) for 15 min at the optimal washing temperature before a final wash with deionized water. Slides were air dried and one drop of Citifluor antifadent (Citifluor Ltd., UK) was added to the sample.
Spatial (10 different locations) and temporal (2 years) changes in characteristics of the Marmara Sea Sediments were monitored to determine interactions between the chemical and microbial diversity. The sediments were rich in terms of hydrocarbon, nitrate, Ni and microbial cell content. Denitrifying, sulfate reducing, fermentative and methanogenic organisms were co-abundant in 15 cm below the sea floor. The local variations in the sediments’ characteristics were more distinctive than the temporal ones. The sulfate and nitrate contents were the main drivers of the changes in the microbial community compositions. N and P were limited for microbial growth in the sediments, and their levels determined the total cell abundance and activity. Seasonal shifts in temperatures of the shallow sediments were also reflected in the active cell abundances. It was concluded that the Marmara Sea is a promising ecosystem for the further investigation of the ecologically important microbial processes.
Comparison of T cell immune responses induced by vectored HIV vaccines in non-human primates and humans
2010, Vaccine
Citation Excerpt :
The open reading frames encode Gag from CAM-1, Pol (including only the reverse transcriptase and integrase gene products) from IIIB, and Nef from JRFL strains [21]. Gene sequences were codon optimized to enhance expression in mammalian cells [22]. The pol transgene segment was inactivated by substituting alanine codons for amino acids at enzymatically active sites [23–29] and the nef transgene segment was inactivated through substitutions, which prevent attachment to the cytoplasmic membrane and retrotrafficking into endosomes [30].
Following the disappointing outcome of the phase IIb test-of-concept step study in which Merck's adenovirus type 5 (Ad5) HIV-1 clade B gag/pol/nef vaccine failed to demonstrate efficacy in HIV high-risk individuals, an extensive review of the trial and preclinical studies which supported the trial is ongoing. One point of interest is how well preclinical nonhuman primate immunogenicity studies predicted what was observed in humans. Here we compare the HIV-1-specific cellular immune responses elicited in nonhuman primates and human clinical trial subjects to several HIV-1 vaccine candidates. We find that although rhesus macaques are immunologically more responsive to vaccination than humans, the hierarchy in potency of single-modality prime–boost regimens using several vector approaches (adenovirus, DNA, and pox vectors) was well predicted. Vaccine approaches using complex formulations such as novel adjuvants (DNA + CRL1005) or mixed-modality prime–boost (DNA/Ad5; Ad5/ALVAC) did not correlate as well between rhesus macaques and humans. Although the immunogenicity of the vaccines and vaccine regimens evaluated were not all accurately predicted, testing in rhesus macaques generally offers an indispensable tool for ranking the immunological potential of HIV-1 vaccine candidates.
Comparative analysis of immune responses induced by vaccination with SIV antigens by recombinant Ad5 vector or plasmid DNA in rhesus macaques
2010, Molecular Therapy
Citation Excerpt :
Five animals were immunized with recombinant Ad5 vectors encoding SIVmac239gag, SIVmac239nef, and SIVmac239pol. Genes coding for Gag, Pol, and Nef were synthesized based on codons frequently used in mammalian cells.31 All genes were based on reported sequences from SIVmac239 with the exception of Nef that was based on the sequence reported for SIVmac251 (ref. 32).
DNA vaccines have undergone important enhancements in their design, formulation, and delivery process. Past literature supports that DNA vaccines are not as immunogenic in nonhuman primates as live vector systems. The most potent recombinant vector system for induction of cellular immune responses in macaques and humans is adenovirus serotype 5 (Ad5), an important benchmark for new vaccine development. Here, we performed a head-to-head evaluation of the Merck Ad5 SIV vaccine and an optimized electroporation (EP) delivered SIV DNA vaccine in macaques. Animals receiving the Ad5 vaccine were immunized three times, whereas the DNA-vaccinated animals were immunized up to four times based on optimized protocols. We observed significant differences in the quantity of IFNγ responses by enzyme-linked immunosorbent spot (ELISpot), greater proliferative capacity of CD8⁺ T cells, and increased polyfunctionality of both CD4⁺ and CD8⁺ T cells in the DNA-vaccinated group. Importantly, Ad5 immunizations failed to boost following the first immunization, whereas DNA responses were continually boosted with all four immunizations demonstrating a major advantage of these improved DNA vaccines. These optimized DNA vaccines induce very different immune phenotypes than traditional Ad5 vaccines, suggesting that they could play an important role in vaccine research and development.

View all citing articles on Scopus

View full text