Characterisation of the merozoite surface protein-2 promoter using stable and transient transfection in Plasmodium falciparum
Introduction
Antibodies inhibitory to Plasmodium falciparum may function through the inhibition of invasion of human red blood cells by the extracellular merozoite form of the parasite. A target of invasion-inhibitory antibodies is the glycosylphosphatidylinositol (GPI)-anchored, integral membrane protein MSP-2, a molecule that is an important malaria vaccine candidate [1], [2], [3]. Antibodies against MSP-2 in human sera are associated with decreased malaria morbidity [4], [5], [6], and in various experimental systems, immunisation with recombinant forms of the molecule protect against malaria challenge [7], [8], [9]. It has been demonstrated that both antibodies to MSP-2 and synthetic MSP-2 peptides inhibit merozoite invasion of red blood cells in vitro [10], [11], implicating this molecule in erythrocyte invasion. However, the function of MSP-2 in invasion remains unknown. Targeted disruption of the MSP-2 gene has not been successful, suggesting that this gene may be essential in P. falciparum [12].
The MSP-2 protein consists of highly conserved amino- and carboxy-termini flanking a variable central region. The variable region contains a central repetitive sequence flanked by non-repetitive regions that have been used to define two major allelic families; the FC27 family and the 3D7/IC-1 family. In addition to MSP-2, a number of other merozoite proteins implicated in erythrocyte invasion demonstrate allelic dimorphism, including MSP-1, MSP-3, and EBA-175 [13], [14], [15]. While these dimorphisms appear not to be involved in alternate erythrocyte invasion pathways [16], it is possible that they may be involved in the formation of protein complexes at the merozoite surface or the transport and trafficking of other polymorphic merozoite surface proteins. Trafficking of merozoite proteins may be dependant upon other proteins and complex formation, for example localisation of RAP-2 is dependant on RAP-1 acting as an escorter protein [17]; it is possible that the dimorphisms observed in other merozoite molecules may involve interactions with other polymorphic proteins at the merozoite surface. These interactions may be crucial for the appropriate trafficking and localisation of merozoite proteins including MSP-2.
MSP-2 is encoded by a single exon on chromosome 2 and is flanked 5′ by the genes encoding merozoite surface proteins MSP-4 and MSP-5 and 3′ by the gene encoding adenylosuccinate lyase (ASL) [18], [19], [20] (Fig. 1A). An MSP-4 cDNA clone characterised previously [21], indicated that MSP-4 transcription initiates in the PFB0315w-MSP-4 intergenic region and terminates in the MSP-4-MSP-5 intergenic region (Fig. 1A) [22]. In the 3D7 parasite line, the intergenic region between MSP-5 and MSP-2 is 1096 bp and presumably contains the MSP-2 promoter since there is no evidence to suggest a polycistronic mRNA containing both the MSP-5 and MSP-2 open reading frames. Indeed, it has been demonstrated that a 2 kb MSP-2 mRNA extends from the MSP-5-MSP-2 intergenic region across the 819 bp MSP-2 open reading frame to terminate in the MSP-2-ASL intergenic region in 3D7 [23]. Analysis of the timing of MSP-2 transcription indicates that while low levels of MSP-2 mRNA may be present in rings, the level of MSP-2 RNA peaks in late-trophozoites and schizonts [23], [24], [25].
It has been shown previously that precise timing of transgene expression is a determinant of subsequent localisation to the merozoite surface in Plasmodium berghei and P. falciparum [26], [27]. In P. berghei, P. falciparum AMA-1 has been expressed under the control of the dihydrofolate reductase (DHFR) and the P. berghei AMA-1 promoters, and is correctly localised only under the control of the AMA-1 promoter when AMA-1 expression begins in late-schizonts. It is thought that this timing of expression is required to coincide with the development of the rhoptries to which AMA-1 localises prior to the merozoite surface [28]. The timing of transgene expression can be equally important for subcellular localisation in P. falciparum, and the choice of promoter for expression at the merozoite surface critical. For instance, correct timing of Plasmodium chabaudi AMA-1 transgene expression is required for localisation of the protein to the rhoptries in P. falciparum; under the control of the calmodulin (CAM) promoter, P. chabaudi AMA-1 localised to what appeared to be the parasite plasma membrane surrounding the developing merozoites [27].
The regulated expression of both merozoite-specific and invasion-associated Plasmodial transgenes is essential for the functional analysis of these molecules. We describe characterisation of the merozoite-specific promoter for the MSP-2 gene and define regions sufficient for transgene expression and localisation of the protein at the merozoite surface. We show promoter regions that drive minimal levels of transgene expression in transient assays are sufficient for expression of FC27 MSP-2 at the merozoite surface.
Section snippets
DNA ligase-dependent amplification (DLDA)
An improved DLDA was used to identify MSP-2 transcription start sites [29], [30]. Following first strand cDNA synthesis using SuperScript II reverse transcriptase (GibcoBRL) with the MSP-2 specific oligonucleotide MSP-2D 5′ GGATTACTTTCTGTCATACTTCTCC 3′, and removal of RNA using RNase H (Promega), a double stranded oligonucleotide anchor with a degenerate four nucleotide overhang [30] was ligated onto the cDNA and the fragment amplified. Semi-nested PCR using an oligonucleotide complementary to
Identification of a putative MSP-2 transcription start site
In order to map the MSP-2 transcriptional start site and facilitate the characterisation of the 3D7 MSP-2 promoter, MSP-2 5′ cDNA ends were amplified using a modified DLDA technique, subsequently cloned into pGEM-T and sequenced [30]. Sequencing of multiple clones identified a single putative transcriptional start site at position -256 relative to the MSP-2 translation start codon (Fig. 1B).
Analysis of the MSP-2 5′ region in transiently-transfected parasites
To confirm that the MSP-2 5′ region contains a functional promoter, the 1096 bp MSP-5-MSP-2 intergenic
Discussion
The ability to express transgenes in P. falciparum allows the analysis of protein trafficking [44], [45], the functional analysis of malaria vaccine candidates [46], and the examination of the importance of antibodies to specific antigens in immunity to malaria [47]. Central to addressing these questions is both the appropriate timing of transgene expression throughout the plasmodial life cycle and the subsequent trafficking to the appropriate subcellular destination. In this study, we have
Acknowledgements
The authors wish to thank Vikki Marshall for kindly providing anti-MSP-4 antibodies, Laura Martin and Allan Saul for providing the anti-FC27 MSP-2 monoclonal antibody 8G10/48, and Simon Weisman and Ross Coppel for kindly providing anti-FVO MSP-2 antisera and MSP-2 recombinant proteins. The authors also wish to thank Junici Watanabe for assistance with the FULL-malaria database, Till Voss for critically reading the manuscript and The Red Cross Blood Service (Melbourne, Australia) for the supply
References (57)
- et al.
Human phase I vaccine trials of 3 recombinant asexual stage malaria antigens with Montanide ISA720 adjuvant
Vaccine
(1999) - et al.
Safety and immunogenicity of a three-component blood-stage malaria vaccine in adults living in an endemic area of Papua New Guinea
Vaccine
(2000) - et al.
46–53 kilodalton glycoprotein from the surface of Plasmodium falciparum merozoites
Mol. Biochem. Parasitol.
(1989) - et al.
Mice immunised with synthetic peptide from N-terminal conserved region of merozoite surface antigen-2 of human malaria parasite Plasmodium falciparum can control infection induced by Plasmodium yoelii yoelii 265BY strain
Vaccine
(1999) - et al.
An epitope recognised by inhibitory monoclonal antibodies that react with a 51 kilodalton merozoite surface antigen in Plasmodium falciparum
Mol. Biochem. Parasitol.
(1988) - et al.
Functional analysis of proteins involved in Plasmodium falciparum merozoite invasion of red blood cells
FEBS. Lett.
(2000) - et al.
Allelic dimorphism in a surface antigen gene of the malaria parasite Plasmodium falciparum
J. Mol. Biol.
(1987) - et al.
Molecular variation in a novel polymorphic antigen associated with Plasmodium falciparum merozoites
Mol. Biochem. Parasitol.
(1994) - et al.
The major allelic dimorphisms in four Plasmodium falciparum merozoite proteins are not associated with alternative pathways of erythrocyte invasion
Mol. Biochem. Parasitol.
(1999) - et al.
Characterisation of the gene encoding adenylosuccinate lyase of Plasmodium falciparum
Mol. Biochem. Parasitol.
(1997)
Close linkage of three merozoite surface protein genes on chromosome 2 of Plasmodium falciparum
Mol. Biochem. Parasitol.
Stage-specific merozoite surface protein 2 antisense transcripts in Plasmodium falciparum
Mol. Biochem. Parasitol.
Transcription of the gene for the merozoite surface antigen MSA2 of the human malaria parasite Plasmodium falciparum during the asexual cycle
FEBS Lett.
Precise timing of expression of a Plasmodium falciparum-derived transgene in Plasmodium berghei is a critical determinant of subsequent subcellular localization
J. Biol. Chem.
Differential localization of full-length and processed forms of PF83/AMA-1 an apical membrane antigen of Plasmodium falciparum merozoites
Mol. Biochem. Parasitol.
Stable transgene expression in Plasmodium falciparum
Mol. Biochem. Parasitol.
Plasmodium falciparum: rapid quantification of parasitemia in fixed malaria cultures by flow cytometry
Exp. Parasitol.
The structure of the calmodulin gene of Plasmodium falciparum
Mol. Biochem. Parasitol.
Physical and functional mapping of the transcriptional start sites of Plasmodium falciparum proliferating cell nuclear antigen
Mol. Biochem. Parasitol.
The DNA polymerase delta promoter from Plasmodium falciparum contains an unusually long 5′ untranslated region and intrinsic DNA curvature
Mol. Biochem. Parasitol.
Analysis of transcriptomes of human malaria parasite Plasmodium falciparum using full-length enriched library: identification of novel genes and diverse transcription start sites of messenger RNAs
Gene
Positive and negative effects of deletions and mutations within the 5′ flanking sequences of Plasmodium falciparum DNA polymerase delta
Mol. Biochem. Parasitol.
Mutational analysis identifies a five base pair cis-acting sequence essential for GBP130 promoter activity in Plasmodium falciparum
Mol. Biochem. Parasitol.
Proteolytic processing and primary structure of Plasmodium falciparum apical membrane antigen-1
J. Biol. Chem.
Plasmodium falciparum possesses a cell cycle-regulated short type replication protein A large subunit encoded by an unusual transcript
J. Biol. Chem.
A recombinant blood-stage malaria vaccine reduces Plasmodium falciparum density and exerts selective pressure on parasite populations in a phase 1-2b trial in Papua New Guinea
J. Infect. Dis.
Relationship between humoral response to Plasmodium falciparum merozoite surface antigen-2 and malaria morbidity in a highly endemic area of Papua New Guinea
Am. J. Trop. Med. Hyg.
Assessment of the role of the humoral response to Plasmodium falciparum MSP2 compared to RESA and SPf66 in protecting Papua New Guinean children from clinical malaria
Parasite Immunol.
Cited by (25)
An epigenetic antimalarial resistance mechanism involving parasite genes linked to nutrient uptake
2013, Journal of Biological ChemistryCitation Excerpt :At the same time, it is important to preserve the stage specificity of clag gene expression because transcripts made on an incorrect schedule in the parasite life cycle may yield protein that either fails to interact with essential ligands or does not traffic properly (42). We selected the well characterized promoter of merozoite surface protein-2 (msp2, PFB0300c) because it, like that of all clag genes, directs maximal transcription at the schizont stage (23, 43). Finally, to avoid silencing mechanisms that depend on the location of the gene within the parasite genome and local heterochromatin formation, we selected the piggyBac transposase system.
Molecular mechanisms of host cell egress by malaria parasites
2012, International Journal of Medical MicrobiologyCitation Excerpt :Originally, the egress of merozoites from the erythrocyte was investigated by treating blood stage parasites with specific protease inhibitors, particularly E64. These early studies resulted in contradictory data and reported that the inhibitor blocked either degradation of the PVM (Salmon et al., 2001; Wickham et al., 2003; Soni et al., 2005) or the erythrocyte HCM (Glushakova et al., 2009). A new biophysics analysis by Chandramohanadas et al. (2011) reported that the membrane-permeable inhibitor E64d and the chelator EGTA-AM inhibit the rupture and increase the stiffness of the erythrocyte HCM.
Control of gene expression in Plasmodium falciparum - Ten years on
2009, Molecular and Biochemical ParasitologyPlasmodium gene regulation: far more to factor in
2008, Trends in ParasitologyCitation Excerpt :It is clear that, as in other eukaryotes, P. falciparum protein-coding genes are transcribed by RNA polymerase II [40], supported by a basal TFIID-based transcription complex [3]. The mRNAs are mono-cistronic and require regulatory information encoded in their promoter regions for proper timing of expression [41–45] (for simplicity, the 5′ untranslated and promoter regions are not distinguished between). The most convincing data that gene expression is regulated by sequence information in 5′-upstream regions is the functional demonstration that the promoters from many genes are necessary and sufficient to drive gene expression stage-specifically [42,46–53].
A 140-bp AT-rich sequence mediates positive and negative transcriptional control of a Plasmodium falciparum developmentally regulated promoter
2008, International Journal for ParasitologyIdentification of basic transcriptional elements required for rif gene transcription
2007, International Journal for Parasitology