Abstract
Inheritance and clearance of maternal mRNAs are two of the most critical events required for animal early embryonic development. However, the mechanisms regulating this process are still largely unknown. Here, we show that together with maternal mRNAs, C. elegans embryos inherit a complementary pool of small non-coding RNAs that facilitate the cleavage and removal of hundreds of maternal mRNAs. These antisense small RNAs are loaded into the maternal catalytically-active Argonaute CSR-1 and cleave complementary mRNAs no longer engaged in translation in somatic blastomeres. Induced depletion of CSR-1 specifically during embryonic development leads to embryonic lethality in a slicer-dependent manner and impairs the degradation of CSR-1 embryonic mRNA targets. Given the conservation of Argonaute catalytic activity, we propose that a similar mechanism operates to clear maternal mRNAs during the maternal-to-zygotic transition across species.
Similar content being viewed by others
Introduction
The elimination of germline-produced mRNAs and proteins in somatic blastomeres and the concomitant activation of the zygotic genome—the maternal to zygotic transition (MZT)—is critical for embryogenesis1. Despite several mechanisms have been discovered to regulate the clearance of maternal mRNAs during the MZT, they only account for the regulation of a small fraction of decayed transcripts, suggesting that factors and pathways responsible for the decay of the majority of maternal mRNAs still remain elusive. In addition, distinct species can adopt different strategies to achieve the clearance of maternal mRNAs. This is why understanding how different species clear maternal mRNAs is fundamental to shed light on additional mechanisms that regulate one of the most important and conserved transitions happening at the beginning of embryogenesis. For instance, small RNAs, such as maternally inherited PIWI-interacting RNAs (piRNAs) in Drosophila2,3 and zygotically transcribed microRNAs (miRNAs) in Drosophila, zebrafish, and Xenopus4,5,6, have been shown to directly regulate the degradation of maternal mRNAs in embryos. However, miRNA functions are globally suppressed in mouse oocytes and zygotes7,8 and they do not appear to contribute to maternal mRNA clearance in C. elegans embryos9. This raises the question of whether other type of small RNAs might play a role in this process. In this regard, catalytically active Argonaute and endogenous small interfering RNAs (endo-siRNAs) have been proposed to play an essential role in oocytes and early embryos in place of miRNAs10,11. Therefore, in addition to the silencing of repetitive elements, the RNA interference (RNAi) pathway might regulate the removal of maternal mRNAs in animal embryos.
In the nematode C. elegans, two waves of maternal mRNA clearance have been documented so far. The first wave of maternal mRNA clearance, regulated by a consensus sequence in the 3′UTR, occurs during the transition from the oocyte to the one-cell embryo9. A second wave of clearance occurs in the somatic blastomeres of the developing embryos12,13. However, to date, no mechanisms are known to regulate this process in the embryo. Endo-siRNAs produced in the germline are known to be heritable and they can potentially regulate mRNA transcripts in the developing embryos. Two main endogenous small RNA pathways regulate heritable epigenetic processes in the C. elegans germline: (1) thousands of piRNAs that target foreign “non-self” mRNAs14 and (2) endogenous antisense small RNAs that target active “self” mRNAs15,16. These antisense small RNAs, called 22G-RNAs, are generated by the RNA-dependent RNA polymerase (RdRP) EGO-1 using target germline mRNAs as a template and are then loaded into the Argonaute CSR-1 (chromosome segregation and RNAi deficient)16,17. CSR-1 22G-RNAs are thought to protect germline mRNAs from piRNA silencing and they are essential for fertility and embryonic development15,18,19. However, CSR-1 is also responsible for the majority of slicing activity in C. elegans extracts and is capable of cleaving complementary mRNAs in vitro20. Moreover, CSR-1 slicer activity is capable of fine-tuning some of its mRNA targets in the adult germline21. Therefore, whether CSR-1 can protect or degrade its germline mRNA targets is still an open question.
Here, we provide insight into the widespread process of maternal mRNA clearance in early developing embryos. We demonstrate that inherited 22G-RNAs loaded into CSR-1 trigger the cleavage and removal of complementary maternal mRNAs during early embryogenesis. We found that target mRNAs have faster degradation rate due to CSR-1. Moreover, they are depleted of ribosomes, and we provide evidence that the translational status of these maternal mRNAs influences their decay. We employed the auxin-inducible degradation (AID) system22 to deplete CSR-1 specifically during the MZT in order to study its functions in early embryos. Using this approach, we demonstrate that the slicer activity of CSR-1 is essential for embryonic viability and is required to post-transcriptionally cleave its embryonic mRNA targets. Given the conservation of Argonaute catalytic activity in metazoans and the conserved function of small RNAs in regulating maternal mRNA clearance in several animal models we propose that a similar mechanism operates to clear maternal mRNAs during the MZT across species.
Results
CSR-1 localized to somatic and germline blastomeres and its slicer activity is essential for embryonic development
To study CSR-1 localization during embryogenesis, we have generated various CRISPR-Cas9-tagged versions of CSR-1 (ref. 23). CSR-1 is expressed mainly in the germline of adult worms17 and localizes in the cytoplasm and germ granules (Supplementary Fig. 1a, b). However, in early embryos, CSR-1 localizes to both the germline and somatic blastomeres (Fig. 1a and Supplementary Fig. 1a, b). CSR-1 in the somatic blastomeres is mainly cytoplasmic and persists for several cell divisions (Fig. 1a and Supplementary Fig. 1b). This is in contrast with other germline Argonaute proteins24,25, such as PIWI, which exclusively segregate with the germline blastomere from the first embryonic cleavage (Fig. 1a and Supplementary Fig. 1b). Animals lacking CSR-1 or expressing a CSR-1 catalytic inactive protein show several germline defects, severely reduced brood sizes, chromosome segregation defects, and embryonic lethality16,21,26.
To understand the role of CSR-1 during embryogenesis, we depleted CSR-1 protein using the AID system22. First, we depleted CSR-1 from the first larval stage (L1), recapitulating the fertility loss and embryonic lethality phenotypes of both csr-1 (tm892) mutant and catalytically inactive CSR-1 mutant worms21,26 (Fig. 1b, c and Supplementary Fig. 2a, b). Next, we depleted CSR-1 from the late L4 stage (Supplementary Fig. 3a, b). This treatment did not significantly decrease the fertility of adult worms (Fig. 1b), yet all the CSR-1-depleted embryos failed to develop in larvae (Fig. 1c), suggesting CSR-1 plays an essential role during embryogenesis.
To test whether the catalytically active CSR-1 is required for embryonic viability during the MZT, we expressed a single transgenic copy of CSR-1, using MosSCI27, with a wild-type catalytic domain (DDH) (named CSR-1 WT) or with an alanine substitution of the first aspartate residues within the catalytic DDH motif (ADH) (named CSR-1 catalytic dead), and depleted endogenous CSR-1 from the late L4 larval stage (Fig. 1d). Western blotting analysis showed that the expression of the transgenic CSR-1 WT and the transgenic CSR-1 catalytic dead proteins are similar, even though their levels are lower than the endogenous CSR-1 protein (Supplementary Fig. 3c). Nonetheless, transgenic CSR-1 WT significantly restored embryonic viability (Fig. 1d), whereas the transgenic CSR-1 catalytic dead failed to suppress the embryonic lethality caused by the depletion of endogenous CSR-1 (Fig. 1d). Thus, CSR-1 slicer activity is essential during embryogenesis.
CSR-1 post-transcriptionally regulates its targets in the embryo
The localization of maternally inherited CSR-1 in the somatic blastomeres during early embryogenesis suggests that CSR-1 and its interacting 22G-RNAs may regulate specific embryonic targets in somatic cells. To better understand the regulatory function of CSR-1 in the embryo, we identified and compared CSR-1-interacting 22G-RNAs in embryos and adult worms. CSR-1 was immunoprecipitated in embryo populations ranging from 1- to 20-cell stage (Supplementary Fig. 4a) or young adult worms, followed by sequencing of interacting 22G-RNAs. CSR-1-22G-RNA targets in the adult germlines and early embryos largely overlap (74%) (Fig. 2a). However, the relative abundance of the 22G-RNAs complementary to these targets was different between the adult germlines and early embryos (Fig. 2a, b). Only 29% of CSR-1 targets with the highest levels of complementary 22G-RNAs (>150 reads per million, RPM) in adults and embryos are shared (Fig. 2a, b). Given that CSR-1 cleavage activity on target mRNAs depends on the density of 22G-RNAs21, our results suggest that CSR-1 may regulate a different subset of mRNAs in the embryos.
To evaluate gene expression changes upon CSR-1 depletion in embryos, we depleted CSR-1 from the late L4 stage and collected early embryo populations fully depleted of CSR-1 (Supplementary Figs. 3a and 4b, c). Analysis of nascent transcription using global run-on sequencing (GRO-seq) revealed that the zygotic transcription in CSR-1 depleted embryos was largely unaffected compared to control untreated embryos (Fig. 2c and Supplementary Fig. 4b), indicating that CSR-1-depleted embryos could initiate zygotic transcription. However, analysis of steady-state mRNA levels using RNA-seq revealed increased levels of CSR-1 embryonic mRNA targets (Fig. 2d and Supplementary Fig. 4c), which correlated with the density of complementary antisense 22G-RNAs loaded onto CSR-1 (Fig. 2d). These results suggest that CSR-1 22G-RNAs in the embryo targets a different set of mRNAs compared to adult germlines and these target mRNAs are directly regulated at the post-transcriptional level in a dose-dependent manner.
CSR-1 contributes to quicken the degradation of maternal cleared mRNA targets
In the first phases of embryogenesis, the embryo is transcriptionally silent and relies on maternally inherited mRNA transcripts. Maternal mRNAs degradation is concomitant with the zygotic genome activation, during the MZT1. To gain insight into the type of mRNA targets regulated by CSR-1, we asked whether CSR-1 embryonic targets corresponded to maternal or zygotic mRNA transcripts. We adapted a sorting strategy28 to obtain embryo populations at the 1-cell stage (99% pure), or enrich for early embryos (from 4- to 20 cells), or late embryos (more than 20 cells) (Supplementary Fig. 4d). Strand-specific RNA-seq was performed on these embryo populations to profile gene expression dynamics. We detected maternal mRNAs from 7033 genes in 1-cell embryos (transcript per million, TPM, >1) (Supplementary Data 1), which we classified into four groups based on their kinetics during embryonic development. “Maternal cleared” mRNAs (1320 genes) corresponded to maternal mRNAs in 1-cell embryos whose levels diminished in early and late stages (Fig. 3a) (Supplementary Data 1). These genes belong to the previously characterized Maternal class II genes, which are maternally inherited in the embryos and degraded in somatic blastomeres12. “Maternal stable” mRNAs (1020 genes) corresponded to maternal mRNAs in 1-cell embryos whose levels are stably maintained in early and late embryos (Fig. 3a) (Supplementary Data 1). “Newly Zygotic” mRNAs (704 genes) whose mRNAs accumulated in early and late embryos but were undetectable in 1-cell embryos (TPM < 1) (Fig. 3a) (Supplementary Data 1), and “Maternal and zygotic” mRNAs (1958 genes) whose mRNAs are inherited in 1-cell embryos (TPM, >1) and their levels increase in early or late embryos (Fig. 3a) (Supplementary Data 1).
Analysis of the embryonic CSR-1 targets revealed that they were inherited in 1-cell embryos and gradually depleted in early and late embryos, similarly to the maternal cleared class of genes (Fig. 3a), suggesting that CSR-1 contributes to maternal mRNA clearance in early embryos. Indeed, the majority of CSR-1 targets were enriched among the category of maternal cleared mRNAs (Supplementary Fig. 5a, b). Next, we analyzed the kinetics of maternal cleared mRNAs that differ in their CSR-1 22G-RNA density. We found that the maternal cleared mRNAs with a high density of CSR-1 22G-RNAs are inherited at higher levels in 1-cell embryos compared to the maternal cleared mRNAs not targeted by CSR-1 (Fig. 3b). Moreover, these mRNA targets show a higher degradation rate (Fig. 3c). These results suggest that in addition to the level of degradation observed for non-target mRNAs, the cleared mRNAs with a high density of CSR-1 22G-RNAs require an additional boost of mRNA degradation to facilitate their clearance in a timely manner. To validate whether CSR-1 is responsible for the faster clearance observed for the maternal mRNA targets, we measured the degradation rate of maternal cleared mRNAs in CSR-1-depleted embryos. Our analysis shows that the depletion of CSR-1 impaired the higher level of degradation of CSR-1 mRNA targets with a high density of 22G-RNAs compared to non-target mRNAs (Fig. 3d). Finally, we analyzed the dynamics of 22G-RNAs on sorted embryo populations at different stages (Supplementary Fig. 4f). Our analysis shows that the 1-cell embryos are already provided with a pool of 22G-RNAs antisense to maternal mRNAs and their levels decreased in late embryonic stages (Fig. 3e). Altogether, our results suggest that C. elegans embryos inherit a pool of CSR-1 22G-RNAs to target abundant maternal mRNAs that require a higher degradation rate to facilitate their clearance. However, we cannot exclude that the inherited level of CSR-1 22G-RNAs is maintained during early embryogenesis through zygotically produced CSR-1 22G-RNAs.
CSR-1 cleaves maternal mRNAs in early embryos
To determine if CSR-1 slicer activity is required for maternal mRNA clearance, we measured gene expression changes in CSR-1-depleted embryos complemented with transgenic expression of CSR-1 catalytic dead or CSR-1 WT (Supplementary Fig. 2c and Supplementary Fig, 2e). Our analysis showed increased accumulation of maternal cleared mRNA targets in slicer-inactive CSR-1 embryos, which correlated with the density of complementary antisense 22G-RNAs loaded onto CSR-1 (Fig. 4a, b). In addition, we cloned and sequenced long (>200 nt) RNAs bearing 5′ monophosphate termini (degradome-seq), which correspond to the end structure generated by Argonaute-mediated cleavage29, to measure the degradation efficiency (degradome-seq/RNA-seq) of embryonic CSR-1 targets in the absence of CSR-1 catalytic activity. Our results show that the degradation efficiency of CSR-1 targets is reduced in slicer-inactive CSR-1 embryos (Fig. 4c).
To study if CSR-1 is directly regulating these maternal mRNA targets in embryos, we performed RNA-seq on CSR-1 depleted in 1- to 4-cell stage enriched embryos or 4- to 20-cell stage enriched embryos (Supplementary Fig. 6a–c). CSR-1 depletion in 1- to 4-cell embryos did not cause global changes in maternal cleared mRNA target levels (Supplementary Fig. 6d). However, CSR-1 depletion in 4- to 20-cell stage enriched embryos resulted in increased levels of maternal cleared mRNA targets compared to 1- to 4-cell embryos (Supplementary Fig. 6d). Finally, to prove that CSR-1 is degrading mRNAs also in somatic blastomeres we performed RNA single-molecule fluorescence in situ hybridization (smFISH) on a maternal cleared CSR-1 mRNA target in CSR-1-depleted and control embryos. We observed reduced maternal mRNA degradation of the CSR-1 target in somatic blastomeres of 20-cell stage embryos depleted of CSR-1 compared to control (Fig. 4d, e and Supplementary Fig. 6e). Thus, CSR-1 and its interacting 22G-RNAs directly regulate maternal mRNA clearance in somatic blastomeres.
CSR-1 preferentially targets maternal mRNAs no longer engaged in translation
To analyze the dynamics of CSR-1-dependent mRNA clearance during embryogenesis, we divided maternal mRNAs (7033) into those degraded early and late during embryogenesis. Early-degraded mRNAs (483 genes) showed at least a twofold reduction in mRNA levels in sorted early embryo populations compared to 1-cell embryos (Fig. 5a and Supplementary Fig. 4d). Late-degraded mRNAs (1572 genes) showed stable levels of mRNAs in sorted early embryo populations compared to 1-cell embryos but were decreased at least twofold in populations of late embryos (Fig. 5a and Supplementary Fig. 4d). Analysis of 22G-RNAs interacting with CSR-1 in the embryo showed that the levels of 22G-RNAs targeting the early-degraded mRNAs were significantly higher compared to late-degraded mRNAs in total RNAs and CSR-1 IPs (Supplementary Fig. 7a, b). Indeed, CSR-1 targets with a high density of 22G-RNAs are highly enriched for early-degraded mRNAs in contrast to late-degraded mRNAs (Supplementary Fig. 7c). In addition, the level of 22G-RNAs antisense to late-degraded mRNAs did not increase during late embryogenesis (Supplementary Fig. 7d). These results together with the observation that CSR-1 is absent in somatic cells during late embryonic development (Supplementary Fig. 1b) suggest that CSR-1 might preferentially regulate early-degraded mRNAs.
Next, we generated metaprofiles for the levels of CSR-1-interacting 22G-RNAs levels along the gene body of early- and late-degraded mRNA targets (Fig. 5b, c). The early-degraded mRNA genes showed an enrichment of CSR-1-loaded 22G-RNAs at the 3′ end of the genes as well as along the whole coding sequence (Fig. 5b, d). The late-degraded mRNA genes instead showed enrichment of CSR-1-loaded 22G-RNAs mainly at the 3′ end, corresponding to the 3′UTR (Fig. 5c, d). Previous reports have shown that the rate of mRNA clearance during MZT is influenced by translational efficiency30,31. Thus, the different translational status of early- and late-degraded mRNAs may influence the accessibility of CSR-1-loaded 22G-RNAs antisense to the coding sequences of cleared mRNAs. To test this hypothesis, we measured ribosomal occupancy by Ribo-seq in a population of early embryos (Supplementary Fig. 7e). Early-degraded mRNAs showed significantly lower ribosomal occupancy and translational efficiency compared to late-degraded mRNAs (Fig. 5e, f). These results suggest that ribosomal loading on maternal mRNAs can influence the accessibility of CSR-1 slicer activity.
Ribosome occupancy affects CSR-1-mediated maternal mRNA clearance
Previous studies have shown that mRNA codon usage can influence translational efficiency and maternal mRNA decay during the MZT30,31. However, the early- and late-degraded mRNAs did not show any differences in their codon usage (Supplementary Fig. 7f, g). Because the translation of germline mRNAs is primarily regulated by their 3′UTR in C. elegans32, we investigated whether different 3′UTRs from early- and late-degraded mRNAs can impact translation and mRNA degradation in early embryos. We generated two single-copy transgenic lines expressing a germline mCherry::h2b mRNA reporter with either a 3′UTR from an early- (egg-6 3′UTR) or a late- (tbb-2 3′UTR) degraded mRNA target (Fig. 6a). The distribution of endogenous CSR-1-bound 22G-RNAs from these two genes resembled the features of early- and late-degraded mRNAs, having a different level of 22G-RNAs mapping on the coding sequence and a similar level on the 3′UTR (Supplementary Fig. 8a). The expression of the two mCherry::h2b mRNA reporters was similar in adult worms (Fig. 6b). However, the level of mCherry::h2b mRNA fused with the early-degraded egg-6 3′UTR was lower in embryo, indicating increased degradation in early embryos (Fig. 6b). To verify that the different 3′UTRs affect the translational efficiency of mCherry::h2b mRNA in embryos we quantified the ribosome occupancy by Ribo-seq and mRNA level by RNA-seq (Supplementary Fig. 8b–d), and observed decreased translational efficiency of mCherry transgenic reporter with egg-6 3′UTR (Fig. 6c). To test whether CSR-1 22G-RNAs contribute to the increased decay of the mCherry::h2b reporter fused to the egg-6 3′UTR, we sequenced small RNAs loaded onto CSR-1 in early embryo populations from the two transgenic lines (Supplementary Fig. 9a). We observed increased levels of total 22G-RNAs (Supplementary Fig. 9b) and CSR-1-bound 22G-RNAs on the coding sequences of the mCherry transgenic reporter with egg-6 3′UTR compared to the tbb-2 3′UTR reporter (Fig. 6d, e and Supplementary Fig. 9c). Given that ribosome translation antagonize CSR-1 22G-RNA biogenesis and targeting in adult worms33, our results suggest that the translation level of maternal mRNAs can influence the rate of CSR-1-mediated mRNA cleavage in early embryos.
In summary, our study identifies a function of the conserved Argonaute slicer activity in the degradation of maternally inherited mRNAs during the MZT.
Discussion
In this study, we have shown that the maternally inherited CSR-1 protein and its interacting 22G-RNAs trigger the cleavage of hundreds of complementary maternal mRNA targets in early embryos. Despite most of the inherited Argonautes localize to the germline blastomeres, the inherited CSR-1 also localizes to the cytoplasm of somatic blastomeres for several cell divisions during early embryogenesis. We have shown that in C. elegans embryos CSR-1 is loaded with 22G-RNAs antisense to mRNAs that undergo rapid degradation during early embryogenesis, and CSR-1 slicer activity facilitates the clearance of these maternal mRNAs. We have observed that the maternal mRNAs targeted by CSR-1 are inherited at higher levels in 1-cell embryos compared to the other maternal cleared mRNAs. Nonetheless, CSR-1 targets show a faster degradation rate, which depends on maternal inherited CSR-1. We have also observed that CSR-1 is preferentially loaded with 22G-RNAs antisense to the coding sequences of untranslated mRNA targets in embryos. Therefore, we propose that CSR-1 slicer activity is required to quicken the degradation of abundant maternal mRNAs that are no longer translated during early embryogenesis.
Translation tunes 22G-RNAs levels regulating the timing of CSR-1 slicing
Based on our results, we speculate that active translation prevents the accessibility of CSR-1 22G-RNAs on complementary mRNA targets and hence the slicing through the coding sequences of translated maternal mRNAs. Therefore, the regulation of translation of maternal mRNAs ensures that CSR-1 22G-RNA complexes can remove these mRNAs only when they are not translated. We have also shown that by modulating the translational activity of a maternal mRNA sequence using different 3′UTRs, we could detect different amounts of antisense 22G-RNAs. Even if we cannot exclude that different features in the 3′UTRs used can influence the production of 22G-RNAs, we speculate that the presence of ribosomes on the coding sequence of maternal mRNAs can antagonize the synthesis of 22G-RNAs by the RdRP. Previous studies suggested that the synthesis of 22G-RNAs by the RdRP EGO-1 starts from the 3′ end of protein-coding transcripts34. We have also recently observed that CSR-1 slicing is required for the production of 22G-RNAs targeting the gene body and this activity is antagonized by translation33. However, CSR-1 slicing is not required for the production of 22G-RNAs targeting the 3′UTR, which depends on the RdRP EGO-1 (ref. 33). Here we found that translated late-degraded maternal mRNAs are devoid of 22G-RNAs targeting the gene body and they only have 22G-RNAs targeting their 3′UTR. On the contrary, untranslated early-degraded maternal mRNAs are targeted by 22G-RNAs along the whole transcript, including the gene body. Based on our findings, we propose that the presence of ribosomes on the coding sequence of late-degraded RNAs can antagonize CSR-1 slicer activity and 22G-RNA synthesis on the gene body to protect late-degraded maternal mRNAs from degradation. On the contrary early-degraded maternal mRNAs are readily able to be degraded by inherited CSR-1-bound 22G-RNAs. Therefore, ribosome translation would act as a molecular clock that determines the timing of CSR-1-dependent degradation of maternal mRNAs during early embryogenesis (Fig. 7). However, how late-degraded maternal mRNAs are degraded in late phases of embryogenesis remains unknown. One possibility would be that once late-degraded maternal mRNAs are not engaged in translation, during late embryogenesis, they would become accessible for CSR-1 slicer activity and RdRP EGO-1 to produce zygotic 22G-RNAs. However, it is important to note that CSR-1 protein is also degraded at around 100-cell stage, where it is only present in the primordial germ cells Z2/Z3 (Fig. 1a and Supplementary Fig. 1b). Moreover, 22G-RNAs antisense to late-degraded mRNAs do not increase during embryogenesis (Supplementary Fig. 7d). For these reasons, CSR-1-mediated degradation of maternal transcripts can also be temporarily regulated and restricted to the early phase of embryogenesis. Thus, we cannot exclude that other unknown mechanisms might participate in the degradation of late-degraded maternal mRNAs in somatic blastomeres.
CSR-1 slicing in adults and early embryos
CSR-1 has been extensively studied in the adult germlines, where it has been proposed to protect active genes from piRNA silencing18,19, promote germline transcription35,36, regulate the biogenesis of histone mRNAs37, and fine-tune germline mRNAs loaded into oocytes21. The catalytic activity of CSR-1 and its gene regulatory function on target mRNAs has been proven to be essential for fertility and chromosome segregations21. Similarly, our work provided evidence that CSR-1 slicer activity is essential for embryonic viability independently from its germline functions. Therefore, we propose that the accumulation of maternal mRNAs in embryos lacking CSR-1 slicer activity might be deleterious for the developing embryo.
Based on our findings we conclude that CSR-1 catalytic activity regulates its targets both in adult germlines and in early embryos. However, the effect on targeted mRNA is different in the two developmental stages. Indeed, while CSR-1 activity only results in a fine tuning of its germline targets, CSR-1 embryonic targets are cleared during early embryogenesis. Importantly, embryos are transcriptionally silent for the first phases of embryogenesis, while CSR-1 targets are also actively transcribed in the C. elegans germline. Therefore, we propose that the CSR-1 slicer activity combined with the differential transcriptional status of CSR-1 targets determines the different gene regulatory outcomes in adults and embryos. Moreover, we have recently reported that CSR-1 slices mRNA targets in the cytosol and not in the germ granules of adult worms33. Therefore, the enrichment of CSR-1 in adult germ granules might further contribute to preventing CSR-1 catalytic activity, which is fully released in the cytosol of somatic blastomeres in embryos.
Maternally inherited mRNAs, including CSR-1 embryonic targets, also accumulates in germline blastomeres, where they colocalize with embryonic germ granules12,25. CSR-1 protein is also expressed in germline blastomeres, but we were unable to evaluate whether CSR-1 is also cleaving mRNAs in these cells. However, CSR-1 catalytic activity is only acting on cytosolic mRNAs33, suggesting that germ-granule localized mRNAs might not be regulated by CSR-1 catalytic activity in embryos. This is also in agreement with the notion that maternal mRNAs localized in germ granules are protected from degradation12,25.
Are 3′UTRs directly involved in the regulation of maternal mRNA decay?
It is known that translation affects maternal mRNA clearance, and recent works have shown how the codon usage of maternal mRNAs regulates translation and degradation rates in zebrafish embryos30,31. Here we show that in C. elegans embryos early- and late-degraded maternal mRNAs do not differ in their codon usage. Instead, we have observed that the 3′UTR is sufficient to regulate the translational efficiency of the coding sequence of a maternal mRNA in embryos, and in turn its degradation rate, including CSR-1 slicer activity. Even if we implicate CSR-1 slicer activity in the degradation of early-degraded mRNAs, we cannot exclude that sequences or other features in the 3′UTR can directly regulate CSR-1 22G-RNA biogenesis and the time of decay observed in early- versus late-degraded maternal mRNAs during MZT. A consensus sequence in the 3′UTR of some maternal mRNAs has been previously shown to play a role in the degradation of mRNAs from oocytes to 1-cell embryos in C. elegans9. Therefore, it would be interesting in future studies to identify other consensus sequences located in the 3′UTR of maternal mRNAs and also RNA-binding proteins that might contribute together with CSR-1 to regulate mRNA clearance during embryogenesis.
Endo-siRNAs may have a conserved role during MZT in metazoans
The requirement of Argonaute slicer activity to degrade endogenous target mRNAs has only been described in the silencing of repetitive elements in animals. Here, we propose that the RNAi activity of CSR-1 on maternal mRNAs might be a conserved mechanism required for the MZT and mRNA clearance across species. Indeed, catalytically active Argonaute proteins are conserved in animals, including humans. For example, of the eight human Argonaute proteins, AGO2 and AGO3 have been shown to possess a catalytic activity able to cleave complementary mRNA targets38,39,40.
Endogenous small RNAs targeting protein-coding genes, similar to the one loaded onto CSR-1, have been detected in mouse oocytes and embryonic stem cells41,42,43. This suggests that mammalian RNAi, in addition to the role in suppressing the expression of repetitive elements, might also regulate endogenous genes. Given that the inheritance of maternal catalytically active Ago2 is essential for oocyte10 and early embryonic development11 in mouse, the current hypothesis is that Ago2 can promote the degradation of maternal mRNAs in embryos44. Strikingly, catalytically inactive Ago2 in mouse oocytes causes chromosome segregation and spindle assemble defects10 similar to CSR-1 catalytic mutant21, suggesting they might regulate common functional mRNA targets during oogenesis. Ago2 also loads miRNAs in mouse. Even if miRNAs contribute to regulate maternal mRNA clearance in some animal models, including Drosophila, zebrafish, and Xenopus, their functions are suppressed in mouse oocytes7,8. Therefore, Ago2 and endogenous small RNAs might play a role in maternal mRNA clearance during the MZT in mouse.
The role of miRNAs in maternal mRNA clearance in C. elegans is also unclear9, despite ALG-1 and ALG-2, the two catalytically competent Argonaute protein loading miRNAs, are essential for embryonic development45,46,47. The C. elegans PIWI protein PRG-1 has also a slicer catalytic activity48. However, PRG-1 segregates with the germline lineage from the first embryonic cleavage and is excluded from somatic blastomeres. Therefore, it is unlikely that C. elegans piRNAs could participate in maternal mRNA clearance as occurs in Drosophila and Aedes2,49.
Based on our findings, we propose that endogenous small RNAs and Argonaute-mediated cleavage of mRNA may be a conserved mechanism in metazoans to degrade maternal mRNAs in oocyte and embryos.
Methods
C. elegans strains and maintenance
Strains were grown at 20 °C using standard methods50. The wild-type reference strain used was Bristol N2. A complete list of strains used in this study is provided in Supplementary Data 2.
Generation of transgenic animals
Generation of CRISPR-Cas9 lines
CRISPR-Cas9 alleles were generated similar to as described in ref. 23. We used a mCherry::3×Flag::ha::csr-1 (ref. 23) as an entry strain to introduce an auxin-inducible Degron tag and obtain a Degron::mCherry::3xFlag::ha::csr-1 strain suitable for the AID of CSR-1, after crossing with CA1352, a strain carrying a single copy of the germline-expressed TIR-1 protein22. CRISPR-Cas9 guide RNA sequences are listed in Supplementary Data 3.
Generation of MosSCI lines
Strains carrying a single copy insertion of mex-5P::gfp::csr-1::tbb-2 3′UTR or mex-5P::gfp::csr-1(ADH)::tbb-2 3′UTR were generated by MosSCI51 and the Gateway Compatible Plasmid Toolkit51. The sequences of csr-1 and csr-1 (ADH) were amplified from genomic DNA by PCR from strains carrying either a wild-type copy of csr-1 or csr-1(ADH) and cloned in pENTR-D-TOPO (Invitrogen). Plasmids used for Multisite Gateway reaction are listed as follows: pJA245, pCM1.36, and pCFJ212. Strain EG6703 was used as an entry strain for single insertion in chromosome IV.
3′UTR replacement experiment
A sequence of 800 bp downstream of the stop codon of egg-6 was amplified from genomic DNA by PCR and used as 3′UTR. We used the single-copy transgene mCherry::his-11::tbb-2 3′UTR as entry strain to insert egg-6 3′UTR by CRISPR-Cas9 as described above. egg-6 3′UTR was inserted right after the STOP codon of his-11. The specific expression of the inserted UTR was validated by reverse transcriptase quantitative PCR (RT-qPCR).
Immunostaining
Gonads were dissected on PBS, 0.1% Tween-20 (PBST) containing 0.3 mM levamisole on 0.01% poly-lysine slides. Samples were immediately freeze cracked on dry ice for 10 min and fixed at −20 °C for 15 min in methanol, and 10 min in acetone. Blocking was performed for 30 min at room temperature. Primary antibody was incubated overnight at 4 °C in PBS, 0.1% Tween-20, 5% BSA. The secondary antibody was incubated for 1 h at room temperature. Washes were performed with PBS, 0.1% Tween-20 (PBST). DNA was stained with DAPI. For embryo immunostaining, a drop of embryos from bleached adults was used instead of gonads. Images of adult germlines and embryos were acquired on a Zeiss LSM 700 confocal microscopy. The primary antibodies used were anti-FLAG (Sigma, F1804) and anti-PRG-1 (gift from the Mello Lab) antibodies at a dilution of 1:500 and 1:800, respectively, and the secondary antibodies used were goat anti-mouse Alexa Fluor 488 (Invitrogen, A11001) and goat anti-rabbit Alexa Fluor 568 (Invitrogen A11011) antibodies at a dilution of 1:500.
Auxin-inducible depletion of CSR-1
Auxin-inducible depletion has been performed as described in ref. 22. In all experiments, 250 mM auxin stock solution was prepared in ethanol and stored at 4 °C. Auxin plates or ethanol plates were prepared by the addition of auxin or only ethanol to NGM plates (final concentration: 500 µM auxin, 0.5% ethanol for auxin plates and 0.5% ethanol for ethanol plates). Plates were seeded with OP50 Escherichia coli, stored at 4 °C, and warmed at room temperature before the experiment. Worms were placed on auxin or ethanol plates from L1 or from late L4 stage as explained for each experiment.
Brood size assays
WT and CSR-1 mutants
Single L1 larvae were manually picked and placed onto NGM plates seeded with OP50 E. coli and grown at 20 °C until adulthood and then transferred on a new plate every 24 h for a total of two transfers. The brood size of each worm was calculated by counting the number of embryos and larvae laid on the three plates. For the auxin-depleted experiments NGM plates were supplemented with ethanol (control) or auxin.
Brood size of CSR-1 auxin-depleted worms during late L4
For CSR-1 depletion during late L4: brood size assay has been performed as described above with the exception that worms were grown from L1 on regular NGM plates and transferred onto auxin or ethanol plates 44 h after hatching and transferred on new corresponding Auxin and Ethanol plates every 24 h for a total of 2 transfers.
Embryonic lethality assay of CSR-1 rescue experiments
Single L1 larvae of strains carrying Degron::CSR-1 complemented with the single-copy insertion Mex-5P::GFP::CSR-1::tbb-2 3′UTR or Mex-5P::GFP::CSR-1(ADH)::tbb-2 3′UTR were manually picked and placed onto NGM plates seeded with OP50 E. coli and grown at 20 °C until adulthood. Since transgene was prone to silencing, adult worms were allowed to lay at least 65 embryos and then adults were removed from the plates and imaged to check for GFP::CSR-1 expression. Only plates from GFP-expressing adults were used for the assay. The percentage of embryonic lethality is calculated by dividing the number of dead embryos for the total number of laid embryos.
Live imaging
Image in Supplementary Fig. 1a (4-cell embryo) was acquired using a Plan-Apochromat ×100/1.46 Oil DIC M27 objective on a Zeiss Axio Imager.M2 equipped with a PIXIS 1024 CCD camera (Princeton Instruments). Images in Supplementary Fig 2b were acquired using a Plan-Apochromat ×40/1.0 DIC M27 objective on a Zeiss Axio Imager.M2 equipped with a PIXIS 1024 CCD camera (Pronceton Instruments).
Western blotting
Worms were lysed in 1× NuPage LDS sample buffer supplemented with 1× NuPAGE Reducing agent (Thermo Fisher Scientific) and heated at 90 °C for 10 min. Protein were resolved on precast NuPAGE Novex 4–12% Bis–Tris gels (Invitrogen). The proteins were transferred on a nylon membrane using the wet transfer Novex Bolt Mini Blot Module (Invitrogen) at 30 V for 2.5 h. The primary antibodies used included anti-CSR-1 (a gift from the Claycomb laboratory, dilution 1:3000) and anti-GAPDH (Ab125247, dilution 1:2000), and the secondary antibodies included anti-rabbit (31469, Pierce) and anti-mouse (31430, Pierce) used at a dilution of 1:10000. The SuperSignal West Pico PLUS Chemiluminescent Substrate was used to detect the signal using a ChemiDoc MP imaging system (Biorad).
Collection of early embryos populations
Synchronous populations of worms were grown on NGM plates until adulthood and were carefully monitored using a stereomicroscope and bleached shortly after worms started to produce the first embryos. After bleaching, Early embryos were washed with cold M9 buffer to slow down embryonic development and immediately frozen in dry ice. A small aliquot of embryo pellet (2 µL) was taken right before freezing and mixed with 10 µL VECTASHIELD® Antifade Mounting Medium with DAPI (Vector laboratories) and immediately frozen in dry ice. DAPI-stained embryos were defrosted on ice and used for counting cell nuclei and score the embryonic cell stage of the population.
Collection of CSR-1-depleted early embryos populations
Early embryos were collected as described above with the exception that worms were transferred on auxin or ethanol plates during late L4.
Collection of early- and late CSR-1-depleted embryo populations
Early populations of CSR-1-depleted embryos were collected as described above with the exception that harvesting was performed at the very beginning of embryo production to further enrich the population in early staged embryos. After bleaching, an aliquot of the same population was allowed to develop further for 1–2 h in M9 containing 500 µM auxin, 0.5% ethanol or 0.5% ethanol. Embryonic cell stage was scored, and harvesting was performed when embryo populations reached the desired developmental stage.
Small RNA-seq library preparation
Total RNA from staged embryo preparations with RIN > 9 was used to generate small RNA libraries. The library preparation was performed similarly to that described in ref. 23.
RNA IP
A synchronous population of 40,000 worms (48 h after hatching) or a preparation of at least 150,000 early embryos was collected and suspended in extraction buffer (50 mM HEPES pH 7.5, 300 mM NaCl, 5 mM MgCl2, 10% glycerol, 0.25% NP-40, protease inhibitor cocktails (Thermo Scientific), 40 U/mL RiboLock RNase inhibitors (Thermo Scientific)). Samples were crushed in a metal dounce on ice performing at least 40 strokes. Crude protein extracts were centrifuged at 12,000 × g at 4 °C for 10 min. Protein was quantified using Pierce™ 660 nm Protein Assay Reagent (Thermo Scientific) and 1 mg (for adults) or 700 µg (for embryos) of protein extract was used for RNA immunoprecipitation as described in ref. 23 and used for sRNA-seq library preparation.
GRO-seq on CSR-1-depleted embryos
Populations containing at least 40,000 CSR-1-depleted early embryos were collected as described above. Early embryos were resuspended in 1.5 mL Nuclei extraction buffer (3 mM CaCl2, 2 mM MgCl2, 10 mM Tris-HCl pH 7.5, 0.25% Np-40, 10% glycerol, protease inhibitors, and RNase inhibitor 4 U/mL) and transferred to a steel dounce and stroked 40 times. The lysate was cleared from cell debris by centrifuging at 100 × g and nuclei were pellet at 1000 × g and washed four times with Nuclei extraction buffer. Nuclei were washed once with Freezing buffer (50 mM Tris-HCl pH 8, 5 mM MgCl2, 0.1 mM EDTA) and resuspended in 100 µL Freezing buffer.
Nuclear Run-On reaction and RNA extraction
Nuclear Run-On (NRO) reaction was performed by addition of 100 µL NRO 2× buffer (10 mM Tris-HCl, 5 mM MgCl2, 1 mM DTT, 300 mM KCl, 1% Sarkosyl, 0.5 mM ATP, CTP and GTP, and 0.8 U/µL RNase inhibitor) and using 1 mM Bio-11-UTP final concentration and incubated for 5 min at 30 °C. NRO reaction was stopped by the addition of TRIzol LS reagent (Ambion) and RNA extraction was performed following the manufacturer’s instructions. Purified RNA was fragmented by the addition of reverse transcriptase buffer and incubated for 7 min at 95 °C.
Biotin RNA enrichment
Biotinylated nascent RNAs were bound to 30 µL Dynabeads MyOne Streptavidin C1 (Invitrogen and) washed three times as described in ref. 52 and purified with TRIZOL reagent.
RNA 5′-end repair
5′-OH of fragmented RNAs were repaired using polynucleotide kinase (Thermo Scientific) following the manufacturer instructions and incubated at 37 ˚C for 30 min. RNA was purified with phenol:chloroform and precipitated by the addition of three volumes of ethanol, 1/10th volumes of 3 M sodium acetate and 30 µg glycoblue coprecipitant (Ambion).
Ligation of 3′ and 5′ Adapter Oligos and second and third biotin enrichments
RNA was ligated to 3′ end adapter using T4 RNA ligase 2 Truncated KQ (home-made) for 16 h at 15 °C. After ligation RNA was purified using solid-phase reversible immobilization beads (SPRI beads) and biotinylated RNA was enriched as described above. After purification RNA was ligated at 5′ end using T4 RNA ligase 1 for 2 h at 25 °C. RNA was purified using SPRI beads and biotinylated RNA was enriched for a third time as described above.
Reverse transcription and amplification of cDNA libraries
Purified RNA was reverse transcribed using SuperScript IV Reverse Transcriptase (Thermo Fisher Scientific) following the manufacturer’s conditions except that reaction was incubated for 1 h at 50 ˚C. cDNA was PCR amplified with specific primers using Phusion High fidelity PCR master mix 2× (New England Biolab) for 18–20 cycles and sequenced on the Illumina Next 500 system.
Degradome-seq
Degradome sequencing have been performed as described in ref. 29.
Sorting of C. elegans embryos
Sorting of C. elegans embryos was performed as described in ref. 28 with the following modifications: a strain expressing both mCherry::OMA-1 and PIE-1::GFP was used to collect embryos enriched in different developmental stages (see Supplementary Fig. 4d, f); embryos after bleaching were fixed with 2% formaldehyde in M9 to block cell division. After sorting, embryos were reverse crosslinked in 250 µL RIPA buffer with RNase inhibitors for 30 min at 70 °C and RNA was extracted with TRIzol LS (Ambion) according to the manufacturer’s instructions.
Strand-specific RNA-seq library preparation
DNase-treated total RNA with RIN > 8 was used to prepare strand-specific RNA libraries. Strand-specific RNA-seq libraries were prepared using the NEBNext® Ultra™ II Directional RNA Library Prep Kit (NEB, E7765) according to the manufacturer’s instructions except that the ribosomal depletion was performed as in ref. 23.
RT-qPCR
One microgram DNase-treated total RNA was used as a template for cDNA synthesis using random hexamers and M-MLV reverse transcriptase. qPCR reaction was performed using Applied Biosystems Power up SYBR Green PCR Master mix following the manufacturer’s instructions and using an Applied Biosystems QuantStudio 3 Real-Time PCR System. Primers used for qPCR are listed in Supplementary Data 4.
Single-molecule FISH (smFISH)
Single-molecule FISH (smFISH) was performed as described in ref. 53. Briefly, embryos were harvested by bleaching, immediately resuspended in methanol at −20 °C, freeze cracked in liquid nitrogen for 1 min, and incubated at −20 °C overnight. Embryos were washed once in wash buffer (10% formamide, 2× SSC buffer (Ambion)) and hybridized with the corresponding FLAP containing probes in 100 µL hybridization buffer (10% dextran sulfate, 2 mM vanadyl-ribonucleoside complex, 0.02% RNAse-free BSA, 50 µg E. coli tRNA, 2× SSC, 10% formamide) at 30 ˚C overnight. Hybridized embryos were washed twice with wash buffer and once in 2× SSC buffer before imaging. Right before imaging, embryos were resuspended in 100 µL antifade buffer (0.4% glucose, 10 µM Tris-HCl pH 8, 2× SSC) with 1 µL catalase (Sigma-Aldrich) and 1 µL glucose oxidase (3.7 mg/mL, Sigma-Aldrich) and stained with VECTASHIELD® Antifade Mounting Medium with DAPI (Vector laboratories). DAPI staining was used to select embryos at 20-cell stage. Images of the central plane of embryos at desired developmental stages were acquired on a Zeiss LSM 700 confocal microscopy. Oligos used for smFISH of C01G8.1 mRNA target are listed in Supplementary Data 5.
The detection of single mRNA molecules was performed with the open-source Matlab package FISH-quant54. Briefly, RNA signal was enhanced by a two-step convolution of the image with Gaussian Kernels. First, the image background obtained by convolution with a large Gaussian Kernel was estimated and then subtracted. Second, the resulting image was filtered with a small Gaussian Kernel to further enhance the signal-to-noise ratio. RNA spots were detected with a local maximum algorithm. For each embryo, a manually drawn outline was used to limit the detection to the somatic blastomeres and exclude the germline blastomere.
Ribo-seq
Ribo-seq has been performed as described in ref. 55 with some modifications. Briefly, embryos harvested by bleaching were lysed by freeze grinding in liquid nitrogen in Polysome buffer (20 mM Tris-HCl pH 8, 140 mM KCl, 5 mM MgCl2, 1% Triton X-100, 0.1 mg/mL cycloheximide) and 1 mg extract was digested by RNase I (100 U) at 37 °C for 5 min and then fractionated on sucrose gradient (10–50%) by ultracentrifugation at 187,000 × g in a SW41-Ti rotor (Beckman Coulter). RNA from monosome fraction was DNase treated and fragments of 28–30 nucleotides were size selected after running on a 15% TBE-Urea gel. 28–30 nucleotide ribosome-protected fragments (RPF) were cloned using the sRNA-seq library preparation method except that the 3′phosphate was removed and 5′ end was phosphorylated by treating RNA with polynucleotide kinase.
Sequencing data analyses
All the sequencing data were demultiplexed with Illumina bcl2fastq converter (version v2.17.1.14) and a quality control was performed with fastQC (version v0.11.5).
For Deg-seq data, raw reads were trimmed at their low-quality 3′ end using seqtk (version 1.3-r115-dirty) as follows: seqtk trimfq -b 4. Trimmed reads were aligned to the C. elegans genome sequence (ce11, C. elegans Sequencing Consortium WBcel235) using Bowtie2 (ref. 56) with default settings. The alignment was also used to generate the bigwig file with bamCoverage from deepTools (version 3.4.3), normalized using counts per million.
For Ribo-seq data, The 3′ adapter was trimmed from raw reads using Cutadapt57 v.1.18 using the following parameter: -a TGGAATTCTCGGGTGCCAAGG -discard-untrimmed. Trimmed reads of size ranging from 28 to 30 nucleotides were selected using bioawk (https://github.com/lh3/bioawk). The selected 28–30-nucleotide reads were aligned to the C. elegans genome sequence (ce11, C. elegans Sequencing Consortium WBcel235) using Bowtie2 (ref. 56) v.2.3.4.3 with the following parameters: -L 6 -i S,1,0.8 -N 0. Reads mapping on sense orientation on annotated protein-coding genes were considered as RPF. Such reads were extracted from mapping results using samtools 1.9 (ref. 58) and bedtools v2.27.1 (ref. 59) and re-mapped on the genome.
Metaprofiles were generated using RPM from sRNA-seq analysis by summarizing normalized coverage information (taken from bigwig files and averaged across replicates) along early-degraded targets or late degraded targets using deeptools60. For RNA-seq, GRO-seq, Degradome-seq, and Ribo-seq, read counts associated to annotated genes were obtained from the alignments using featureCounts v.1.6.3 (ref. 61). Normalized abundances were estimated from read counts by first normalizing by transcript union exon length (reads per kilobase, RPK), then by million total RPK (transcripts per million, TPM). Mean TPM was computed by taking the mean across replicates. For Degradome-seq data, degradation efficiency was measured as the log2 of the ratio between mean TPM of Degradome-seq and RNA-seq reads. For Ribo-seq data, translational efficiency was measured as the log2 of the ratio between mean TPM of ribosomal protected fragments and of transcripts from RNA-seq, adding a pseudo-count of 1 to both terms of the ratio (in order to avoid discarding genes for which no transcript was detected in RNA-seq).
Calculation of enrichment factor
Predicted CSR-1 embryonic targets in different gene expression categories have been calculated as follows, considering the total number of C. elegans protein-coding genes (20,447): [(total number of CSR-1 embryonic targets) × (number of genes in the gene expression category)/total number of C. elegans protein-coding genes].
Enrichment have been calculated as the ration between observed and predicted genes for each gene expression category.
RSCU calculation
RSCU for earlier and later degraded mRNAs was calculated using a CAI calculator (http://genomes.urv.es/CAIcal/).
Gene lists
Gene lists are provided in Supplementary Data 1.
Reporting summary
Further information on research design is available in the Nature Research Reporting Summary linked to this article.
Data availability
All sequencing data (Degradome-seq, GRO-seq, Ribo-seq, RNA-seq, and sRNA-seq from total lysate or IP experiments) that support the findings of this study have been deposited in Gene Expression Omnibus (GEO) database with the accession code GSE146062. All other data supporting the findings of this study are available from the corresponding author on reasonable request. Source data are provided with this paper.
References
Yartseva, V. & Giraldez, A. J. The maternal-to-zygotic transition during vertebrate development: a model for reprogramming. Curr. Top. Dev. Biol. 113, 191–232 (2015).
Rouget, C. et al. Maternal mRNA deadenylation and decay by the piRNA pathway in the early Drosophila embryo. Nature 467, 1128–1132 (2010).
Barckmann, B. et al. Aubergine iCLIP reveals piRNA-dependent decay of mRNAs Involved in germ cell development in the early embryo. Cell Rep. 12, 1205–1216 (2015).
Giraldez, A. J. et al. Deadenylation and clearance of maternal mRNAs. Science 312, 75–80 (2006).
Lund, E., Liu, M., Hartley, R. S., Sheets, M. D. & Dahlberg, J. E. Deadenylation of maternal mRNAs mediated by miR-427 in Xenopus laevis embryos. RNA 15, 2351–2363 (2009).
Bushati, N., Stark, A., Brennecke, J. & Cohen, S. M. Temporal reciprocity of miRNAs and Their targets during the maternal-to-zygotic transition in Drosophila. Curr. Biol. 18, 501–506 (2008).
Ma, J. et al. MicroRNA activity is suppressed in mouse oocytes. Curr. Biol. 20, 265–270 (2010).
Suh, N. et al. MicroRNA function is globally suppressed in mouse oocytes and early embryos. Curr. Biol. 20, 271–277 (2010).
Stoeckius, M. et al. Global characterization of the oocyte-to-embryo transition in Caenorhabditis elegans uncovers a novel mRNA clearance mechanism. EMBO J. 33, 1751–1766 (2014).
Stein, P. et al. Essential role for endogenous siRNAs during meiosis in mouse oocytes. PLoS Genet. 11, 1–19 (2015).
Lykke-Andersen, K. et al. Maternal argonaute 2 is essential for early mouse development at the maternal-zygotic transition. Mol. Biol. Cell 19, 4383–4392 (2008).
Seydoux, G. & Fire, A. Soma-germline asymmetry in the distributions of embryonic RNAs in Caenorhabditis elegans. Development 120, 2823–2834 (1994).
Baugh, L. R. Composition and dynamics of the Caenorhabditis elegans early embryonic transcriptome. Development 130, 889–900 (2003).
Shirayama, M. et al. PiRNAs initiate an epigenetic memory of nonself RNA in the C. elegans germline. Cell https://doi.org/10.1016/j.cell.2012.06.015 (2012).
Wedeles, C. J., Wu, M. Z. & Claycomb, J. M. Protection of germline gene expression by the C. elegans argonaute CSR-1. Dev. Cell https://doi.org/10.1016/j.devcel.2013.11.016 (2013).
Claycomb, J. M. et al. The Argonaute CSR-1 and its 22G-RNA cofactors are required for holocentric chromosome segregation. Cell 139, 123–134 (2009).
van Wolfswinkel, J. C. et al. CDE-1 affects chromosome segregation through uridylation of CSR-1-bound siRNAs. Cell 139, 135–148 (2009).
Ashe, A. et al. PiRNAs can trigger a multigenerational epigenetic memory in the germline of C. elegans. Cell https://doi.org/10.1016/j.cell.2012.06.018 (2012).
Seth, M. et al. The C. elegans CSR-1 argonaute pathway counteracts epigenetic silencing to promote germline gene expression. Dev. Cell https://doi.org/10.1016/j.devcel.2013.11.014 (2013).
Aoki, K., Moriguchi, H., Yoshioka, T., Okawa, K. & Tabara, H. In vitro analyses of the production and activity of secondary small interfering RNAs in C. elegans. EMBO J. 26, 5007–5019 (2007).
Gerson-Gurwitz, A. et al. A small RNA-catalytic argonaute pathway tunes germline transcript levels to ensure embryonic divisions. Cell 165, 396–409 (2016).
Zhang, L., Ward, J. D., Cheng, Z. & Dernburg, A. F. The auxin-inducible degradation (AID) system enables versatile conditional protein depletion in C. elegans. Development 142, 4374–4384 (2015).
Barucci, G. et al. Small-RNA-mediated transgenerational silencing of histone genes impairs fertility in piRNA mutants. Nat. Cell Biol. 22, 235–245 (2020).
Wan, G. et al. Spatiotemporal regulation of liquid-like condensates in epigenetic inheritance. Nature 557, 679–683 (2018).
Ouyang, J. P. T. et al. P granules protect RNA interference genes from silencing by piRNAs. Dev. Cell 50, 716–728 (2019). e6.
Yigit, E. et al. Analysis of the C. elegans Argonaute family reveals that distinct Argonautes act sequentially during RNAi. Cell 127, 747–757 (2006).
Frøkjær-Jensen, C. et al. Single copy insertion of transgenes in C. elegans. Nat. Genet. 40, 1375–1383 (2008).
Stoeckius, M. et al. Large-scale sorting of C. elegans embryos reveals the dynamics of small RNA expression. Nat. Methods 6, 745–751 (2009).
Han, B. W., Wang, W., Li, C., Weng, Z. & Zamore, P. D. PiRNA-guided transposon cleavage initiates Zucchini-dependent, phased piRNA production. Science 348, 817–821 (2015).
Bazzini, A. A. et al. Codon identity regulates mRNA stability and translation efficiency during the maternal‐to‐zygotic transition. EMBO J. 35, 2087–2103 (2016).
Mishima, Y. & Tomari, Y. Codon usage and 3’ UTR length determine maternal mRNA stability in Zebrafish. Mol. Cell 61, 874–885 (2016).
Merritt, C., Rasoloson, D., Ko, D. & Seydoux, G. 3’ UTRs are the primary regulators of gene expression in the C. elegans germline. Curr. Biol. 18, 1476–1482 (2008).
Singh, M. et al. Translation and codon usage regulate Argonaute slicer activity to trigger small RNA biogenesis. Preprint at https://doi.org/10.1101/2020.09.04.282863 (2020).
Gu, W. et al. Distinct Argonaute-mediated 22G-RNA pathways direct genome surveillance in the C. elegans germline. Mol. Cell https://doi.org/10.1016/j.molcel.2009.09.020 (2009).
Cecere, G., Hoersch, S., O’Keeffe, S., Sachidanandam, R. & Grishok, A. Global effects of the CSR-1 RNA interference pathway on the transcriptional landscape. Nat. Struct. Mol. Biol. 21, 358–365 (2014).
Conine, C. C. et al. Argonautes promote male fertility and provide a paternal memory of germline gene expression in C. elegans. Cell https://doi.org/10.1016/j.cell.2013.11.032 (2013).
Avgousti, D. C., Palani, S., Sherman, Y. & Grishok, A. CSR-1 RNAi pathway positively regulates histone expression in C. elegans. EMBO J. https://doi.org/10.1038/emboj.2012.216 (2012).
Liu, J. et al. Argonaute2 is the catalytic engine of mammalian RNAi. Science 305, 1437–1441 (2004).
Park, M. S. et al. Human Argonaute3 has slicer activity. Nucleic Acids Res. 45, 11867–11877 (2017).
Meister, G. et al. Human Argonaute2 mediates RNA cleavage targeted by miRNAs and siRNAs. Mol. Cell 15, 185–197 (2004).
Watanabe, T. et al. Endogenous siRNAs from naturally formed dsRNAs regulate transcripts in mouse oocytes. Nature 453, 539–543 (2008).
Tam, O. H. et al. Pseudogene-derived small interfering RNAs regulate gene expression in mouse oocytes. Nature 453, 534–538 (2008).
Babiarz, J. E., Ruby, J. G., Wang, Y., Bartel, D. P. & Blelloch, R. Mouse ES cells express endogenous shRNAs, siRNAs, and other microprocessor-independent, dicer-dependent small RNAs. Genes Dev. 22, 2773–2785 (2008).
Svoboda, P. & Flemr, M. The role of miRNAs and endogenous siRNAs in maternal-to-zygotic reprogramming and the establishment of pluripotency. EMBO Rep. 11, 590–597 (2010).
Vasquez-Rifo, A. et al. Developmental characterization of the microRNA-specific C. elegans Argonautes alg-1 and alg-2. PLoS ONE https://doi.org/10.1371/journal.pone.0033750 (2012).
Grishok, A. et al. Genes and mechanisms related to RNA interference regulate expression of the small temporal RNAs that control C. elegans developmental timing. Cell 106, 23–34 (2001).
Bouasker, S. & Simard, M. J. The slicing activity of miRNA-specific Argonautes is essential for the miRNA pathway in C. elegans. Nucleic Acids Res. 40, 10452–10462 (2012).
Bagijn, M. P. et al. Function, targets, and evolution of Caenorhabditis elegans piRNAs. Science https://doi.org/10.1126/science.1220952 (2012).
Halbach, R. et al. A satellite repeat-derived piRNA controls embryonic development of Aedes. Nature 580, 274–277 (2020).
Brenner, S. The genetics of Caenorhabditis elegans. Genetics 77, 71–94 (1974).
Zeiser, E., Frøkjær-Jensen, C., Jorgensen, E. & Ahringer, J. MosSCI and gateway compatible plasmid toolkit for constitutive and inducible expression of transgenes in the C. elegans germline. PLoS ONE 6, 3–8 (2011).
Core, L. J., Waterfall, J. J. & Lis, J. T. Nascent RNA sequencing reveals widespread pausing and divergent initiation at human promoters. Science 322, 1845–1848 (2008).
Tsanov, N. et al. smiFISH and FISH-quant—a flexible single RNA detection approach with super-resolution capability. Nucleic Acids Res. 44, e165 (2016).
Mueller, F. et al. FISH-quant: automatic counting of transcripts in 3D FISH images. Nat. Methods 10, 277–278 (2013).
Aeschimann, F., Xiong, J., Arnold, A., Dieterich, C. & Großhans, H. Transcriptome-wide measurement of ribosomal occupancy by ribosome profiling. Methods 85, 75–89 (2015).
Langmead, B. & Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nat. Methods 9, 357–359 (2012).
Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet J. https://doi.org/10.14806/ej.17.1.200 (2011).
Li, H. et al. The sequence alignment/map format and SAMtools. Bioinformatics 25, 2078–2079 (2009).
Quinlan, A. R. BEDTools: the Swiss-army tool for genome feature analysis. Curr. Protoc. Bioinformatics 47, 11.12.1–34 (2014).
Ramírez, F. et al. deepTools2: a next generation web server for deep-sequencing data analysis. Nucleic Acids Res. 44, W160–W165 (2016).
Liao, Y., Smyth, G. K. & Shi, W. FeatureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 30, 923–930 (2014).
Acknowledgements
We would like to thank all the members of the Cecere laboratory and Nicola Iovino for the helpful discussions on the paper and suggestions on the project. We thank G. Riddihough from Life Science Editors for comments on the manuscript. We thank the Mello and the Dumont laboratories for sharing strains and reagents. Some strains were provided by the CGC, funded by NIH Office of Research Infrastructure Programs (P40 OD010440). This project has received funding from the Institut Pasteur, the CNRS, and the European Research Council (ERC) under the European Union’s Horizon 2020 research and innovation program under grant agreement no. ERC-StG-679243. E.C. was supported by a Pasteur-Roux Fellowship program. P.Q. was supported by Ligue Nationale Contre le Cancer (S-FB19032).
Author information
Authors and Affiliations
Contributions
G.C. and P.Q. identified and developed the core questions addressed in the project. G.C. wrote the paper with the contribution of P.Q., E.C., and M.S. P.Q. performed most of the experiments and analyzed the results together with G.C. E.C. and L.B. generated all the lines used in this study with the help of P.Q. M.S. performed the immunoprecipitation of CSR-1 and small RNA sequencing in adult worms and performed the ribo-seq experiments together with P.Q. B.L. performed all the bioinformatic analysis. F.M. analyzed the smFISH experiments. C.D. helped P.Q. in setting up the embryo FACS sorting.
Corresponding author
Ethics declarations
Competing interests
The authors declare no competing interests.
Additional information
Peer review information Nature Communications thanks the anonymous reviewers for their contributions to the peer review of this work. Peer review reports are available.
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Source data
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Quarato, P., Singh, M., Cornes, E. et al. Germline inherited small RNAs facilitate the clearance of untranslated maternal mRNAs in C. elegans embryos. Nat Commun 12, 1441 (2021). https://doi.org/10.1038/s41467-021-21691-6
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/s41467-021-21691-6
This article is cited by
-
Molecular mechanisms of transgenerational epigenetic inheritance
Nature Reviews Genetics (2022)
-
Small RNA pathways in the nematode Ascaris in the absence of piRNAs
Nature Communications (2022)
-
Histone variant H2A.Z regulates zygotic genome activation
Nature Communications (2021)
-
Translation and codon usage regulate Argonaute slicer activity to trigger small RNA biogenesis
Nature Communications (2021)
-
Arginine methylation promotes siRNA-binding specificity for a spermatogenesis-specific isoform of the Argonaute protein CSR-1
Nature Communications (2021)
Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.