Abstract
Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it’s not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5′ CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3′) was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species’ ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.
Similar content being viewed by others
Introduction
Adulteration and counterfeiting of medicinal plant products is a global problem1, 2, especially in developing areas such as Africa, Latin America, and Asia3, 4. The WHO (World Health Organization) estimated that as many as 30% of medicines sold in some Asian areas are adulterated4,5,6, and the occurrence of incorrect species as medicinal herb substitutes in Brazilian markets may be as high as 71%7. Even in developed countries, illegal supply chains aiding the diffusion of counterfeit drugs also exist2. Adulterated and counterfeit plant medicines are persistent in commercial markets, of which online businesses present considerable threats to both consumers’ health and a social security issues8. A previous study from our group showed that out of 1260 samples from 7 primary TCM markets in China, approximately 4.2% were identified as adulterants9. According to another study, only 40% of Rhodiola products on the market were authentic10. In China, there are many Chinese patent medicines (CPMs) with complex recipes. Decoction, extracts or CPMs made by spurious medicinal materials could undoubtedly be a considerable hazard to consumer health. Currently, a great number of herbal medicines are exported aboard in the form of extracts or CPMs. Therefore, more attention should be given to safety control of these products.
Lonicerae japonicae Flos (Jinyinhua) derived from L. japonica is one of the most commonly used traditional Chinese medicines and is widely planted in China, Japan, Korea and Southeast Asia11 for the extraction of the main active medicinal components with high levels: chlorogenic acid (CGA)12, 13. Lonicerae japonicae Flos can be widely-ranged used in over hundreds of CPMs and natural health products (NHP) in the light of the Chinese Pharmacopeia (2015) or some sort of folk medicines, indicating the hugely demanded quantity and a considerable risk of adulteration or counterfeiting. There are claims in the industry that the high quality of Lonicerae japonicae Flos, rich in chlorogenic acid (CGA), are often adulterated or counterfeited for profit with Eucommiae Folium (E. ulmoides Oliv; Duzhongye) or Lonicerae Flos (Shanyinhua). Eucommiae Folium is derived from a completely different genera, and Lonicerae Flos can be derived from 4 different species including L. marantha (syn. L. fulvotomentosa), L. confusa, L. hypoglauca, and L. macranthoides. Lonicerae Flos is much cheaper than Lonicerae japonicae Flos14. According to the theory of traditional Chinese medicine characteristics, Eucommiae Folium and Lonicerae japonicae Flos have totally different pharmacology, so the two herbal materials should be clearly distinguished. Microscopy is a primary method of identification in CPMs, but the unique microscopic characteristics are undetectable when herbs are ground into ultrafine powders with particle diameters of less than 10 microns. Additionally, it is hard to identify Lonicera species in extracts or in CPMs simply through HPLC using CGA as a marker. Based on the methods in the Chinese Pharmacopeia (2015), it is impossible detect Eucommiae Folium or Lonicerae Flos adulterants in extracts or CPMs labelled as Lonicerae japonicae Flos.
DNA barcoding has been used successfully to identify botanical species of medicinal plants15,16,17. The ITS2 (internal transcribed spacer 2), is a well-used DNA barcode region, exhibiting a 91% PCR recovery efficiency and possessing both high inter-species divergence and intra-species conservation16, 18. Hou et al. used ITS2 to identify Lonicerae japonicae Flos from Lonicerae Flos19, but this method is not feasible for extracts and CPMs where the DNA is heavily degraded into fragments that are smaller than what has been defined as a plant barcode region: >260 bp in ITS2 and >500 bp in rbc L. As almost every CPMs is prescription of complexity, merely one universal primer pair for ITS2 or any other barcode amplification for dozens of herbal products’ identification may not be a wise choice. Lo et al. demonstrated that 121 bp DNA fragments cannot be amplified in processed samples, whereas an 88 bp fragment was obtained successfully after the TCM materials had been boiled for 120 min20. Tiina Sarkinen also concluded that the PCR success rate had strong correlation with the amplicon size in which shorter fragments had a higher success rate21. DNA barcoding is somewhat antiquated as it is by a definition limited to the use of specific DNA barcode regions using Sanger sequencing, followed by species assignments within the barcode of life library, which has limited coverage for medicinal plant species and very poor estimates of intraspecific variation. This presents considerable impediments to the commercial use because the defined plant barcode regions are known to have low PCR and sequence success rates for processed samples4, 22. This is partly due to fact that DNA barcodes are too long for processed materials. Furthermore the proposed plant DNA barcode regions may not be useful to differentiate closely related medicinal species23.
We propose one derivative technology for testing commercial NHPs that build on the foundation of DNA barcoding. One approach is to utilize a “nucleotide signature” that is unique to the target species but much shorter than a common DNA barcode sequence. Our research presented here is focused on developing a contemporary molecular diagnostic tool for testing authentic Lonicerae japonicae Flos (L. japonica Thunb.; Jinyinhua) ingredients in NHPs. The goal of this study was to develop a short nucleotide signature for E. ulmoides and a SNP double peak detection method for Lonicerae Flos to distinguish the adulterant in the Lonicera extracts and CPMs. We validated these methods in detecting authentic species of Lonicerae japonicae Flos (L. japonica Thunb.; Jinyinhua) and targeted adulterant species including Eucommiae Folium (E. ulmoides Oliv.) and Lonicerae Flos (4 Lonicera spp.) by testing commercial market samples including 1) 20 extracts and 2) 47 CPMs.
Results
Nucleotide Signature Development and Detection for Ingredient Substitution
We successfully developed a nucleotide signature and specific primer pairs for E. ulmoides. The success rate of the PCR amplification of the 420 bp ITS2 sequence by the universal primer pair 2 F/3R (More details about primer sequences in Table S2) from 24 Eucommiae Folium samples was 100%. There was no intraspecific variation detected when assessing the alignment of all the ITS2 sequences for all the populations Eucommiae Folium. We did not need to assess closely related species, as E. ulmoides is a single species in the Eucommiaceae family. According to the result of this alignment, one completely conserved 34 bp nucleotide signature (5′ CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3′) from E. ulmoides was identified. BLAST results (Fig. 1) of this nucleotide signature demonstrated that this motif is unique to Eucommiae Folium and can be used to differentiate Eucommiae Folium from all the other species present in the NCBI database or BOLD database. In order to determine if this nucleotide signature detectable in processed NHP extracts, we tested 20 commercial extracts of Lonicerae japonicae Flos. A specific primer pair (DZF1/DZR1) (More details about primer sequences in Table S2) was developed to amplify the target fragments of E. ulmoides of which the length of the amplicon was c. 210 bp. The PCR products from this amplicon which were of the appropriate size were obtained and visualized on a gel (Fig. 2). The nucleotide signature was then sequenced to ensure that the identity of the amplified region from the extracts.
Verification of the Nucleotide Signature Method Using NHP Extracts and CPMs
The nucleotide signature method successfully detected authentic and adulterated products in NHP extracts and CPMs. We used the species-specific primer pairs DZF1/DZR1 to amplify the nucleotide signature of Eucommiae Folium from the extracts and CPMs of Lonicerae japonicae Flos. The results showed that most targets could be amplified successfully, with exception of 2 extracts and 4 CPMs, which did not produce PCR products. A total of 18 batches of Lonicerae japonicae Flos extracts (TQWS1-S18) and 2 batches of Lonicerae Flos extracts (TQWS19-S20) were analysed (Table 1). Substitution with Eucommiae Folium was detected in 10/18 extracts and 5/44 CPMs, including Lingyangganmao soft capsules (ZCY03), Yinhuang soft capsules (ZCY04), Liyanjiedu particle (ZCY15), Jinsangkaiyin pills (ZCY22) and Xiaoerresuqing particles (ZCY34) (Table 2).
Development and Validation of Double Peaks Quantification Method Based on SNP Sites
Two Single-nucleotide polymorphisms (SNPs) were identified for use in the double peak analysis Lonicera spp. used in NHPs. We evaluated 52 samples of Lonicera, L. macranthoides, L. macrantha, L. confuse and L. hypoglauca from all over China in which we amplified the ITS2 sequence using the universal primer pair 2 F/3R. The success rate of PCR amplification was 100%, and the size of ITS2 sequence was 420 bp. Sequence analysis of samples revealed 2 SNPs (16 bp and 64 bp) among the samples of Lonicerae japonicae Flos and Lonicera Flos. The SNP sites G and C specifically occurred in Lonicerae japonicae Flos, while A and T were present at the SNP positions in the four original species of Lonicerae Flos (Fig. 3). The specificity of the two SNPs was consistent among all the sequences obtained from Lonicerae materials.
Experimental mixtures of Lonicerae japonicae Flos and four different Lonicerae Flos were used to validate the quantitative estimates from the SNP double peak method. Powdered Lonicerae japonicae Flos - Lonicerae Flos were mixed in ratios (15:1, 4:1, 1:4, 1:15) that emulate adulteration. The trace data from PCR products of mixed powders with Lonicerae japonicae Flos-Lonicerae Flos ratios indicates that the relative amounts of substituted species can be detected by height of the two peaks at SNP positions (Fig. 4). In the impurity samples, Lonicerae Flos contamination rates can be detected from Lonicerae japonicae Flos as low as 6.2% (15:1) through the trace data (Fig. 4A). Double peaks could be clearly examined at SNP positions and the height of the peaks could indicate the ratio roughly, e.g. at the ratio of 15:1, the main peaks G/C attributed to Lonicerae japonicae Flos were much higher than the lower peaks A/T attributed to Lonicerae Flos, which means that the sample was adulterated with a little Lonicerae Flos. at the ratio of 1:15 (Fig. 4B), the main peaks A/T attributed to Lonicerae Flos were much higher than the lower peaks G/C attributed to Lonicerae japonicae Flos, which means that the sample was adulterated with a lot of Lonicerae Flos. Based on the results, we took the advantage of the SNP double peak methods for identification of the Chinese patent medicine.
The utility of the SNPs was tested on Lonicera NHP extracts. A specific primer pair (JYHF1/JYHR1) (More details about primer sequences in Table S2) was developed to amplify extracts based on the double peak method at the SNP sites. The length of the amplicon was c. 110 bp. 20 extracts were analysed of which two samples were not amplified. Diagnostic PCR products could be amplified successfully from 18 extracts of which double peaks were detected at the two SNP sites indicating that a sample contained both Lonicerae japonicae Flos and Lonicerae Flos. Further analysis of the peak trace at SNP sites indicated that 4 samples were substituted with Lonicerae Flos and 10 batches were adulterated with Lonicerae Flos. A comparison of the relative heights of the two peaks indicated that 6 batches of extracts contained more Lonicerae Flos than Lonicerae japonicae Flos. Only 1 batch of Lonicerae japonicae Flos and 2 batches of Lonicerae Flos were found to be authentic.
The utility of the SNPs was tested on Lonicerae Chinese patented medicine. In this study, all of the 47 CPMs are commonly used medicines, including 43 CPMs containing Lonicerae japonicae Flos and 4 batches containing Lonicerae Flos. A 110 bp fragment resulting from amplification with the specific primer pair JYHF1/JTHR1 was successfully observed for 44 samples (Table 2). The amplification efficiency was 93.62%. Double peak SNP were present and based on relative heights of the double peak, only 10 CPMs were authentic, 34 CPMs samples were substituted or adulterated. Quantitative estimates of mixtures are based on the relative heights of the double peaks (Fig. 5).
Double peaks are relative higher for Lonicerae japonicae Flos than that of Lonicerae Flos within the following samples (examples): Yinhuang soft capsules (ZCY04), Weicyinqiao tablets (ZCY14), Liyanjiedu particles (ZCY15), Qingguo tablets(ZCY16), Yinhuang particles (first batch)(ZCY33). Relative peaks are higher for the adulterant Lonicerae Flos in the following samples (examples): Lingyangqingfei particles (ZCY02), Shuanghuanglian particles (ZCY05), Yinqiaojiedu particles (ZCY13), Kanggan particles (ZCY17). Product substitution with Lonicerae Flos was found in the following samples (examples): Qingkailing pills (ZCY01), Zhizijinhua pills (first batch) (ZCY08), Shouwu pills (ZCY12). Substitution with large amounts of Lonicerae Flos, with only trace amounts of Lonicerae japonicae Flos detected within samples of Shuanghuanglian particles (ZCY30), Yinzhihuang particles (second batch) (ZCY43), Xiaoerjiebiao particles (second batch) (ZCY47). Three samples of the lesser-valued CPMs labelled as containing Lonicerae Flos actually contained the more valuable Lonicerae japonicae Flos; Moreover, 4 batches of CPMs contains Lonicerae Flos including Ganmaozhike particles, Weicyinqiao tablets, Kouyanqing particles and Yinqiaoshangfeng capsules.
There is considerable variation among batches for different groups of Chinese medicine. In order to compare the adulterants of the same CPMs from different batches, we analysed five different groups of CPMs including Yinzhihuang particles (three batches), Zhizijinhua pills (four batches), Lingyingqingfei pills (two batches), Fufangjinyinhua particles (three batches), xiaoerjiebiao particles (two batches) and Yinhuang particles (two batches). The first and the second batch of Fufangjinyinhua particles were substituted with Lonicerae Flos, but the second batch had relatively more Lonicerae japonicae Flos, and the third batch was authentic Lonicerae japonicae Flos. Among the four batches of Zhizijinhua pills, three of them were substituted with Lonicerae Flos, and one was substituted with Lonicerae Flos. The two batches of Yinhuang particles from different manufacturers were substituted with Lonicerae Flos, of which the first had more Lonicerae japonicae Flos and the second had more Lonicerae Flos.
Nucleotide Signature and SNP Double Peak Methods combined for Lonicera NHP Quality Assurance
A combined analysis of the nucleotide signature and double peak methods revealed considerable adulteration of Lonicera NHPs. These results demonstrate the applicability of both primer pairs DZF1/DZR1 and JYHF1/R1 in the identification of Lonicerae japonicae Flos components in extracts and CPMs. We found that 9 batches of extracts consisted of both of two adulterants: Eucommiae Folium and Lonicerae Flos. Product substitution was detected in four samples, without any trace of Lonicerae japonicae Flos. Only one sample of Lonicerae japonicae Flos was authentic; unadulterated with neither Eucommiae Folium nor Lonicerae Flos detected. Two of the less expensive Lonicerae Flos extracts had no adulterants (Table 1). Among all of the 44 CPMs in this study, eight batches were substituted with Lonicerae Flos, 26 samples were found to be substituted, including three batches of CPMs (Lingyangganmao soft capsules (ZCY03),Yinhuang soft capsules (ZCY04), Liyanjiedu particles (ZCY15)), which contained both Eucommiae Folium and Lonicerae Flos, In addition, we detected six samples of extracts and three CPMs were found to be substituted with Lonicerae Flos more than Lonicerae japonicae Flos. Only ten CPMs were found to be authentic (Table 2).
Discussion
The Need for Molecular Diagnostics Tools for Quality Assurance of Lonicera NHPs
Lonicerae japonicae Flos is a widely used medicinal product in China, Japan, Korea, and Southeast of Asia11. The current quality assurance (QA) standard test for Lonicerae japonicae Flos products is utilizes analytical chemistry in detecting the content of CGA according to the current Chinese Pharmacopeia regulations24. There is great variation (5% to 95%) in the CGA content within Lonicerae japonicae Flos extracts in the market, which has become the basis for determining product prices. Compared to extracts, Chinese patent medicine (CPMs) and made up of complicated mixtures of herbs, which presents a considerable impediment for accurate analysis of CGA content. However, it is still used as a QA tool and detection index for identification of some CPMs containing Lonicerae japonicae Flos25. There are no publications that define the level variation in standard deviations associated with CGA measurements, nor statistics to assess the probability of false negatives or positive QA test. This is surprising given the amount of data that is available from routine QA testing of Lonicera NHPs. Managers of quality assurance in the NHP industry are searching for more accurate tools to assess Lonicera quality and assess the risk of adulteration in the supply chain.
Common adulterants pose considerable levels of uncertainty in the routine CGA estimates used in QA of Lonicera NHPs. Eucommiae Folium, Lonicerae japonicae Flos and Lonicerae Flos contain CGA and Eucommiae Folium has different pharmacological functions when mixed with Lonicerae japonicae Flos26,27,28,29. If these adulterants are present, then it is not possible to use CGA estimates as a detection method to distinguish between Lonicerae japonicae Flos and the common adulterants. Although there are many advanced chemical methods that provide appropriate analysis tools to adulteration in drugs and NHPs, the current standard methods in Chinese Pharmacopeia (2015) cannot determine if the samples are adulterated with Eucommiae Folium or Lonicerae Flos. This poses a problem for consumers, as they may not be getting the appropriate product and value that they have purchased. There is potential health risk to consumers as Lonicerae Flos can more easily lead to anaphylactic reactions than that of Lonicerae japonicae Flos30.
Molecular diagnostic tools provide an alternative method for NHP quality assurance and supply chain verification. The ITS2 sequence has been used to effectively identify the authenticity of raw herbal materials31, 32. The short length of ITS2 may have advantages over other DNA barcodes that are on average over 500 bp. However, the DNA barcode ITS2 may not be the best option for the identification of many mixed botanicals such as in CPMs, or processed extracts. This is because DNA degradation occurs during the manufacturing and processing steps, which leads to PCR amplification failure. Additionally, the complexity of the mixtures can lead to a mixed result and thus influence the level of accuracy. For CPMs like capsules, particles or pills, compressing and digesting are also compulsory parts of the production process according to the Chinese Pharmacopeia. The procedure of CPMs Shuanghuanglian particles production, for instance, includes boiling the Lonicerae japonicae Flos for 1.5 hours, filtrating in batches, and finally concentration of the product33. DNA degradation inevitably occurs during these multiple procedures and as a result, DNA sequences are always present as shorter fragments than is defined by DNA barcoding, even for the shorter region of ITS (260 bp). This may explain the failure of some PCR amplifications in many barcoding studies as the DNA template may have been too damaged to serve as a PCR template. Thus, mini-sequences (<120 bp) have become increasingly useful to enhance the success rate of obtaining DNA from NHPs31. According to research on Gingko biloba herbal dietary supplements, a designed mini-sequence approach has been used as a successful tool for detecting adulteration in the supply chain34. A mini-sequence based on a specific primer set may be unique to one species, which provides a unique molecular diagnostic tool for authenticating botanical ingredients35.
Molecular Diagnostic Tools for Supply Chain Validation of Authentic Lonicera NHPs
There are many claims in the NHP industry that some manufactures deliberately add Eucommiae Folium and Lonicerae Flos to meet the standard of CGA indicated in the Chinese Pharmacopeia (2015). Unfortunately there is no analytical chemical method to detect these adulterants. Nucleotide signatures can be used to authenticate Lonicera NHPs (extracts and CPMs) and identify the common adulterant Eucommiae Folium. In previous researches, we successfully developed a nucleotide signature for American ginseng and Angelicae sinensis Radix8, 36. We successfully used nucleotide signatures to differentiate these two medicinal plants from common adulterants in powders and CPMs. This research provided a foundation for the work in the present study another short length (34 bp) nucleotide signature for the adulterant Eucommiae Folium in extracts or CPMs of Lonicerae japonicae Flos. E. ulmoides is a single species in the Eucommiaceae family that possess a unique nucleotide signature that is not a variable site within population; BLAST analysis with CBI GenBank and BOLD did not match to any other taxa. This unique nucleotide signature provides a quick tool that can be adapted to PCR technology. The food borne pathogen industry has utilized this approach as a commercial tool for quick screening of species within the supply chain. We suggest that this tool could be used for many NHP species including that of Ginseng noted above for quality assurance and supply chain validation that insures the authenticity of botanical ingredients.
The SNP double peak detection method can be used to address issues of mixtures of adulterants
Adulteration with Lonicerae Flos is only one specific example of systemic problem in CPMs and many NHPs. SNP have been used extensively in molecular diagnostics as they are very useful for differentiating closely related species37. Chen et al. utilized the SNP double peak detection method to analyse mixtures of American ginseng and Panax ginseng by analysing the height of the double peak38. Our study provides further evidence that this method is useful for accurately detecting adulteration in experimental mixtures of more than two species. This required the use of two SNPs sites within the ITS2 region of L. japonica, L. macranthoides, L.macrantha, L. confuse and L. hypoglauca. We also found that the relative heights of the double peaks of mixtures of Lonicerae japonicae Flos and Lonicerae Flos, is a quantitative estimate of the relative amounts of adulteration. The SNP double peak method could be a quick method for quantitative adulterant detection in many other CPMs and NHPs.
Our study used molecular diagnostics to detect considerable adulteration in Lonicera NHPs. We found adulteration of commercial high value Lonicerae japonicae Flos with lesser-valued Lonicerae Flos in 33 CPMs and 12 extracts. Previous claims of adulteration in Lonicera NHPs by the industry are supported by our research and we have several plausible explanations. Firstly, the adulteration may occur early in the supply chain at the source of production on the farms. This is a complicated issue related to planting history and is not fraudulent adulteration, as the farmers may not understand the complexities of Lonicera nomenclature. This is particularly a problem when considering traditional common names for these Chinese medicines. Previously Lonicerae japonicae Flos or Lonicerae Flos were classified as the same herbal material39. Recently the Chinese Pharmacopeia (2015) has stipulated that Lonicerae Flos derived from L. macrantha, L. confusa, L. hypoglauca and L. macranthoides should be named “Shanyinghua”. Lonicerae japonicae Flos derived from L. japonica is called “Jingyinghua”. The change from synonymous to distinct names may have led to confusion among the farmers producing and labelling the raw materials in the supply chain. In our study, 3 batches of CPMs containing Lonicerae Flos were adulterated with the higher quality Lonicerae japonicae Flos, which indicates that the manufacturer could not distinguish the original materials, which resulted in a loss of potential revenue. Secondly, adulteration may be economically motivated. Lonicerae japonicae Flos is much more expensive than Lonicerae Flos, so some businesses may use Lonicerae Flos as a substitute to increase profits. Lastly, adulteration may occur because there are no tools to verify and validate authentic botanical ingredients for the quality control of Lonicera NHPs. It is a fact that the authentic and known adulterants have similar morphology (they look similar) and chemical composition. Our research provides a molecular diagnostic tool that addresses these plausible explanations for adulteration, and could be used for supply chain validation and possible regulation of Lonicera NHPs.
The regulation of Lonicera NHPs in China and globally needs to have careful consideration. Currently the Food and Drug Administration (FDA) in China considers it illegal when a CPM containing an unlisted species; this is a counterfeit CPMs. Although we provide molecular diagnostic tools for supply chain quality assurance, the use of this technology must be based on the need to differentiate Lonicera taxa. There is some research that suggests that there is no difference in medicinal efficacy40, 41. This might suggest that Lonicerae Flos could be merged into Lonicerae japonicae Flos. However, the Food and Drug Administration (FDA) in China stated that if manufacturers want to change the descriptions of Lonicera CPMs, there are should be an official inquiry and investigation of evidence to support such a change. Regardless of efficacy there is a perceived difference in the medicinal and consequent value of these different botanical ingredients and economically motivated adulteration is likely to occur. Our estimates (83% extracts and 78% CPMs) of Lonicera adulteration identify a considerable issue that must be addressed by all the stakeholders in the NHP industry including producers, suppliers, manufactures, distributors, regulators and perhaps most importantly the consumers.
Materials and Methods
Sampling of Study Material
A total of 76 herbal samples of L. japonica, L. macranthoides, L. macrantha, L. confusa, L. hypoglauca and E. ulmoides were collected as our biological reference material (BRM) library (Table S1). All the samples were authenticated at the species level by professor Yulin Lin (Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences.) and voucher specimens were deposited in the herbarium of the Institute of Medicinal Plant Development. A total of 20 Lonicerae extracts that contained CGA levels ranging from 5–8% were collected from stores in Dalian city, Liaoning province, Xi’an city, Shaanxi province, Changsha city, Hunan province Heze city, Shandong province, Chengdu city and Deyang city, Sichuan province (Table 1). A total of 43 CPM containing Lonicerae japonicae Flos and 4 batches of CPM containing Lonicerae Flos described in the Chinese Pharmacopeia (2015) were purchased from drug stores in Beijing and online pharmacy stores (Table 2).
DNA Extraction, Amplification, and Sequencing
Flower buds and leaves were sterilized with 75% ethanol, and approximately 20 mg of each sample was then ground by ball-milling (Retsch, Germany). DNA was extracted with the Plant Universal Genomic DNA Kit (Tiangen Biotech Beijing Co., China) according to the manufacturer’s instructions. Amplification of ITS2 sequence was performed by the universal primer pair ITS2 2 F/3R (2.5µmol/µL). The PCR mixture contained 2 µL template DNA, 2.5 µL PCR buffer (10×), 2 µL Mg2+(25 mmol/L), 2 µL dNTP mixture (2.5 mmol/L), 1.0 µL 2 F/3R (2.5µmol/L)42, and 1.0 U Taq DNA polymerase. PCR was run for a total of 40 cycles with the following temperatures and times: 94 °C for 30 s, 56 °C for 30 s, and 72 °C for 45 s, followed by an incubation at 72 °C for 10 min. After detection of PCR products by gel electrophoresis, PCR products were bidirectionally sequenced using the ABI 3730XL DNA sequencer (Applied Biosystems).
Extracts and Chinese Patent Medicine
A total of 40–50 mg of extracts or Chinese patent medicine were placed in a tube and ground by ball-milling machine (Retsch, Germany). Six tubes were taken in parallel for each batch of extracts or CPMs. DNA was extracted with the Plant Universal Genomic DNA Kit (Tiangen Biotech Beijing Co., China) according to the manufacturer’s instructions. Finally, DNA from each batch of extracts or CPMs was combined in a single tube and concentrated. The degraded DNA was amplified using two primer pairs (DZF1/DZR1 and JYHF1/JYHR1) newly designed using Primer 6.0 software. Details of these primers are shown in Table S2. The PCR mixture contained 2 µL template DNA, 2.5 µL PCR buffer (10×), 2 µL Mg2+ (25 mmol/L), 2 µL dNTP mixture (2.5 mmol/L), 2.0 µL specific primers DZF1/DZR1 and JYHF1/JYHR1 (2.5µmol/L) separately, and 1.0 U Taq DNA polymerase. PCR was run for a total of 40 cycles at 94 °C for 30 s, 56 °C for 30 s, and 72 °C for 45 s, followed by incubation at 72 °C for 10 min. After the detection of PCR products by gel electrophoresis, the PCR products were directionally sequenced using the ABI 3730XL DNA sequencer (Applied Biosystems).
Mixture of Lonicerae japonicae Flos and Lonicerae Flos Raw-Plant Powders
Lonicerae japonicae Flos and Lonicerae Flos were mixed at ratios of 15:1, 4:1, 1:4 and 1:15. Then, DNA was extracted from the mixed powder with the Plant Universal Genomic DNA Kit (Tiangen Biotech Beijing Co., China) according to the manufacturer’s instructions. Amplification of nucleotide signatures from single species and from the mixtures was performed using the specific primer pair JYHF1/JYHR1(2.5µmol/µL). PCR products were bidirectionally sequenced using the ABI 3730XL DNA sequencer (Applied Biosystems).
Sequence Analysis
ITS2 sequences were assembled using CodonCode Aligner 3.7.1 (CodonCode Co., Germany). The low-quality sequence data were removed from both ends of the sequencing results. All ITS2 sequences from E. ulmoides and Lonicera were annotated and delimited using a hidden Markov Model (HMM)-based method to eliminate the 5.8 S and 28 S rDNA regions43. The haplotypes of every E. ulmoides and Lonicera species were selected by CodonCode Aligner. All the haplotypes were then aligned using MEGA 5 software44.
References
Mackey, T. K. & Liang, B. A. Improving global health governance to combat counterfeit medicines: a proposal for a UNODC-WHO-Interpol trilateral mechanism. BMC Med. 11, 233 (2013).
Gaudiano, M. C. et al. Health risks related to illegal and on-line sale of drugs and food supplements: results of a survey on marketed products in Italy from 2011 to 2013. Ann Ist Super Sanita. 52, 128–132 (2016).
Medina, E., Bel, E. & Sune, J. M. Counterfeit medicines in Peru: a retrospective review (1997-2014). BMJ Open. 6, e010387 (2016).
Shanmughanandhan, D., Ragupathy, S., Newmaster, S. G., Mohanasundaram, S. & Sathishkumar, R. Estimating Herbal Product Authentication and Adulteration in India Using a Vouchered, DNA-Based Biological Reference Material Library. Drug Saf. 39, 1211–1227 (2016).
Wilczynski, S., Koprowski, R. & Blonska-Fajfrowska, B. Directional reflectance analysis for identifying counterfeit drugs: Preliminary study. J Pharm Biomed Anal. 124, 341–346 (2016).
Newton, P. N., Green, M. D. & Fernandez, F. M. Impact of poor-quality medicines in the ‘developing’ world. Trends Pharmacol Sci. 31, 99–101 (2010).
Palhares, R. M. et al. Medicinal plants recommended by the world health organization: DNA barcode identification associated with chemical analyses guarantees their quality. PLoS One. 10, e0127866 (2015).
Wang, X., Liu, Y., Wang, L., Han, J. & Chen, S. A Nucleotide Signature for the Identification of Angelicae Sinensis Radix (Danggui) and Its Products. Sci Rep. 6, 34940 (2016).
Han, J. et al. An authenticity survey of herbal medicines from markets in China using DNA barcoding. Sci Rep. 6, 18723 (2016).
Xin, T. et al. Survey of commercial Rhodiola products revealed species diversity and potential safety issues. Sci Rep. 5, 8337 (2015).
Park, E. et al. Anti-inflammatory activity of herbal medicines: inhibition of nitric oxide production and tumor necrosis factor-alpha secretion in an activated macrophage-like cell line. Am J Chin Med. 33, 415–424 (2005).
Ren, M. T. et al. Identification and quantification of 32 bioactive compounds in Lonicera species by high performance liquid chromatography coupled with time-of-flight mass spectrometry. J Pharm Biomed Anal. 48, 1351–1360 (2008).
Chen, C. Y. et al. Simultaneous determination of iridoids, phenolic acids, flavonoids, and saponins in Flos Lonicerae and Flos Lonicerae Japonicae by HPLC-DAD-ELSD coupled with principal component analysis. J Sep Sci. 30, 3181–3192 (2007).
Zhang, X., Guo, Q. & Yu, B. Rapid quantitative analysis of adulterant Lonicera species in preparations of Lonicerae Japonicae Flos. J Sep Sci. 38, 4014–4020 (2015).
Chen, S. et al. Validation of the ITS2 region as a novel DNA barcode for identifying medicinal plant species. PLoS One. 5, e8613/ journal.pone.0008613 (2010).
Yao, H. et al. Use of ITS2 region as the universal DNA barcode for plants and animals. PLoS One. 5 e13102/journal.pone.0013102 (2010).
Newmaster, S. G. a. R. Ethnobotany Genomics. [invited chapter]. In: Recent Advances in Plant-Based, Traditional and Natural Medicines. Edited by S. Vemulpad and J Jamie. CRC Press, Taylor & Francis, Waretown, NJ, USA (2014).
Han, J. et al. The short ITS2 sequence serves as an efficient taxonomic sequence tag in comparison with the full-length ITS. Biomed Res Int. 2013, 741476 (2013).
Hou, D. et al. Stability and accuracy assessment of identification of traditional Chinese materia medica using DNA barcoding: a case study on Flos Lonicerae Japonicae. Biomed Res Int. 2013, 549037 (2013).
Lo, Y. T., Li, M. & Shaw, P. C. Identification of constituent herbs in ginseng decoctions by DNA markers. Chin Med. 10, 1 (2015).
Sarkinen, T., Staats, M., Richardson, J. E., Cowan, R. S. & Bakker, F. T. How to open the treasure chest? Optimising DNA extraction from herbarium specimens. PLoS One. 7, e43808/journal.pone.0043808 (2012).
Urumarudappa, S. K. et al. DNA barcoding and NMR spectroscopy-based assessment of species adulteration in the raw herbal trade of Saraca asoca (Roxb.) Willd, an important medicinal plant. Int J Legal Med. 130, 1457–1470 (2016).
Group, C. P. W. A DNA barcode for land plants. Proc Natl Acad Sci. 106, 12794-12797/pnas.0905845106 (2009).
Chinese Pharmacopoeia Commission. Pharmacopoeia of the Peoples Republic of China. (ed. Chen, Z.) 221 (China Medical Science Press, 2015).
Chinese Pharmacopoeia Commission. Pharmacopoeia of the Peoples Republic of China. (ed. Chen, Z.) 1154 (China Medical Science Press, 2015).
Chinese Pharmacopoeia Commission. Pharmacopoeia of the Peoples Republic of China. (ed. Chen, Z.) 166 (China Medical Science Press, 2015).
Hao, S. et al. Chlorogenic acid-enriched extract from Eucommia ulmoides leaves inhibits hepatic lipid accumulation through regulation of cholesterol metabolism in HepG2 cells. Pharm Biol. 54, 251–259 (2016).
Luo, L. et al. Antihypertensive effect of Eucommia ulmoides Oliv. extracts in spontaneously hypertensive rats. J Ethnopharmacol. 129, 238–243 (2010).
Feng, B., Wang, X., Zhang, J. & Xu, X. Comparative Study on the Content of Chlorogenic Acid in Lonicera japonica Flos and Lonicera Flos from Different Producing Areas. J Anhui Agri. 26(6), 399–400 (2012).
Liu, J. The quality study and safety test in japonica species, Beijing University of Chinese Medicines (2014).
de Boer, H. J., Ichim, M. C. & Newmaster, S. G. DNA Barcoding and Pharmacovigilance of Herbal Medicines. Drug Saf. 38, 611–620 (2015).
Newmaster, S. G., Grguric, M., Shanmughanandhan, D., Ramalingam, S. & Ragupathy, S. DNA barcoding detects contamination and substitution in North American herbal products. BMC Med. 11, 222 (2013).
Chinese Pharmacopoeia Commission. Pharmacopoeia of the Peoples Republic of China. (ed. Chen, Z.) 739 (China Medical Science Press, 2015).
Little, D. P. Authentication of Ginkgo biloba herbal dietary supplements using DNA barcoding. Genome. 57, 513–516 (2014).
Parveen, I., Gafner, S., Techen, N., Murch, S. J. & Khan, I. A. DNA Barcoding for the Identification of Botanicals in Herbal Medicine and Dietary Supplements: Strengths and Limitations. Planta Med. 82(14), 1225–35 (2016).
Liu, Y. et al. A Nucleotide Signature for the Identification of American Ginseng and Its Products. Front Plant Sci 7, 319 (2016).
Merrill, K. R., Coleman, C. E., Meyer, S. E., Leger, E. A. & Collins, K. A. Development of single-nucleotide polymorphism markers for Bromus tectorum (Poaceae) from a partially sequenced transcriptome. Appl Plant Sci 4 (2016).
Chen, X. et al. A fast SNP identification and analysis of intraspecific variation in the medicinal Panax species based on DNA barcoding. Gene. 530, 39–43 (2013).
Chinese Pharmacopoeia Commission. Pharmacopoeia of the Peoples Republic of China. 177 (China Medical Science Press, 2000).
Wang, F. & Gao, S. Current Research Status of Pharmacology of Honeysuckle and Lonicera Confusa. J Liaoning University of TCM. 15, 239–239 (2013).
Zhang, X., Tong, J., Zhou, Y. & Xu, X. Studies on medicinal ingredients and pharmacological effects of Lonicera. Chin Phar Bul.l 30(8), 1049–1054 (2014).
Chiou, S. J., Yen, J. H., Fang, C. L., Chen, H. L. & Lin, T. Y. Authentication of medicinal herbs using PCR-amplified ITS2 with specific primers. Planta Med. 73, 1421–1426 (2007).
Keller, A. et al. 5.8S-28S rRNA interaction and HMM-based ITS2 annotation. Gene. 430, 50–57 (2009).
Tamura, K. et al. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol. 28, 2731–2739 (2011).
Acknowledgements
We thank our colleagues who helped with sample collection, identification, laboratory work and manuscript preparation, including Dianyun Hou among others. This work was supported by the grants from the National Natural Science Foundation of China (No. 81673552) and CAMS Innovation Fund for Medical Sciences (CIFMS, 2016-I2M-3-016).
Author information
Authors and Affiliations
Contributions
J. H., J.S., S.C. conceived the study and participated in its design. Z. G., Y. L., X.W. contributed samples and carried out the experiments. Z. G. analyzed the data and drafted the manuscript. S.N., S.R. contributed to revising the manuscript. All authors have read and approved the final manuscript.
Corresponding author
Ethics declarations
Competing Interests
The authors declare that they have no competing interests.
Additional information
Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Gao, Z., Liu, Y., Wang, X. et al. Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines. Sci Rep 7, 5858 (2017). https://doi.org/10.1038/s41598-017-05892-y
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/s41598-017-05892-y
Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.