Increased TCR signal strength in DN thymocytes promotes development of gut TCRαβ(+)CD8αα(+) intraepithelial lymphocytes

Grandjean, Capucine L.; Sumaria, Nital; Martin, Stefania; Pennington, Daniel J.

doi:10.1038/s41598-017-09368-x

Download PDF

Article
Open access
Published: 06 September 2017

Increased TCR signal strength in DN thymocytes promotes development of gut TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ intraepithelial lymphocytes

Capucine L. Grandjean¹,
Nital Sumaria¹,
Stefania Martin¹ &
…
Daniel J. Pennington¹

Scientific Reports volume 7, Article number: 10659 (2017) Cite this article

1774 Accesses
7 Citations
Metrics details

Subjects

Abstract

CD4⁽⁺⁾CD8⁽⁺⁾ “double positive” (DP) thymocytes differentiate into diverse αβ T cell sub-types using mechanistically distinct programs. For example, conventional αβ T cells develop from DP cells after partial-agonist T cell receptor (TCR) interactions with self-peptide/MHC, whereas unconventional αβ T cells, such as TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ intraepithelial lymphocytes (IELs), require full-agonist TCR interactions. Despite this, DP cells appear homogeneous, and it remains unclear how distinct TCR signalling instructs distinct developmental outcomes. Moreover, whether TCR signals at earlier stages of development, for example in CD4⁽⁻⁾CD8⁽⁻⁾ double negative (DN) cells, impact on later fate decisions is presently unknown. Here, we assess four strains of mice that display altered TCR signal strength in DN cells, which correlates with altered generation of unconventional TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IELs. FVB/n mice (compared to C57BL/6 animals) and mice with altered preTCRα (pTα) expression, both displayed weaker TCR signalling in DN cells, an inefficient DN-to-DP transition, and reduced contribution of TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IELs to gut epithelium. Conversely, TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IEL development was favoured in mice with increased TCR signal strength in DN cells. Collectively, these data suggest TCR signal strength in DN cells directly impacts on subsequent DP cell differentiation, fundamentally altering the potential of thymocyte progenitors to adopt conventional versus unconventional T cell fates.

Factors that influence the thymic selection of CD8αα intraepithelial lymphocytes

Article 01 June 2020

Thymic-specific regulation of TCR signaling by Tespa1

Article 17 July 2019

How autoreactive thymocytes differentiate into regulatory versus effector CD4+ T cells after avoiding clonal deletion

Article Open access 23 March 2023

Introduction

T cell receptor-expressing intraepithelial lymphocytes (IELs) are epithelial-resident T cells found at numerous body locations¹. Gut IELs display anti-microbial and anti-inflammatory properties and are central to the control of intestinal epithelial homeostasis². A large proportion of gut IELs express TCRαβ, and can be further characterized by expression of CD8αβ or CD8αα dimers³. TCRαβ⁽⁺⁾CD8αβ⁽⁺⁾ IELs are termed “conventional”, closely sharing gene expression signatures with CD8αβ⁽⁺⁾ T cells from secondary lymphoid organs^{4, 5}. By contrast, “unconventional” TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IELs do not require priming in lymphoid structures, appear restricted to the gut epithelium, and display gene expression signatures more similar to γδ T cells^{4, 5}.

Initial studies suggested that unconventional TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IELs develop extra-thymically in gut lymphoid structures known as cryptopatches⁶. However, TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IELs are severely reduced in athymic nude mice, and fate-mapping experiments suggested they traverse the CD4⁽⁺⁾CD8⁽⁺⁾ double positive (DP) stage in the thymus⁷. Further work implicated agonist self-peptide-mediated selection through TCRαβ at the DP stage⁸, and identified pre- and post-selection progenitor subsets⁹. Nonetheless, it remains unclear how “strong” TCR-agonist signals in DP cells instruct positive selection of TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IELs instead of driving negative selection. Indeed, unconventional TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IELs were recently found to express TCRs that had been “recycled” from strong negatively selecting signals¹⁰.

Although TCRαβ signalling at the DP stage appears critical for TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IEL development, the DP stage is not the first in which TCR signalling occurs. DP cells arise from CD4⁽⁻⁾CD8⁽⁻⁾ double negative (DN) cells in a process known as “β-selection” that is mediated by signalling through the preTCR (rearranged TCRβ paired with invariant pTα)¹¹. PreTCR signalling is generally considered weak, due to very low surface preTCR expression¹². By contrast, stronger signalling in DN cells, for example by TCRγδ, is less efficient at generating DP cells; instead driving cells to a γδ T cell fate^{13, 14}.

Successful transition through the β-selection checkpoint results in cell survival, extensive proliferation, and significant differentiation, events that may be mechanistically linked¹⁵. Although TCR signal strength in DN cells clearly affects the efficient induction of these processes, it is presently unclear whether it also affects the future fate of the DP cells that are generated. Here, we begin to investigate this idea in the context of TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IEL development. We show that FVB/n wild type (WT) mice have a much reduced TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IEL compartment when compared with WT C57BL/6 animals, that correlates with weaker preTCR signalling at the β-selection checkpoint. Indeed, by reducing preTCR signal strength in pTα-transgenic animals we re-capitulate this relative absence of gut TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IELs. By contrast, in two mouse models in which TCR signal strength is greater in DN cells by forced expression of TCRαβ, increased generation of TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IELs was observed. Thus, these data provide evidence that TCR signal strength at the DN-to-DP transition directly influences the efficiency of TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IEL development.

Results

Reduced TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IELs in FVB/n mice

We had noted that FVB/n wild type (WT) mice, in comparison with C57BL/6 WT mice, had significantly reduced unconventional TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IELs in the small intestine (Fig. 1A) (total IEL yields from the two strains were variable but not significantly different (Fig. 1B)). By contrast, the proportion of conventional TCRαβ⁽⁺⁾CD8αβ⁽⁺⁾ IELs was increased in FVB/n mice, and TCRγδ⁽⁺⁾ IELs were comparable between the two strains (Fig. 1C). Unconventional TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IELs are thought to develop in the thymus from cells that are CD4^(lo)CD8^(lo)TCRδ⁽⁻⁾TCRβ⁽⁺⁾CD5^(hi)CD69⁽⁺⁾PD-1⁽⁺⁾CD122⁽⁺⁾ (Sup Figure S1)¹⁶. C57BL/6 mice possess ~3.5 × 10⁵ of these cells. However, consistent with a reduced unconventional IEL compartment, the comparative subset of FVB/n mice was significantly lower at ~2 × 10⁵ cells (Fig. 1D). IEL progenitors develop from CD4⁽⁺⁾CD8⁽⁺⁾ double positive (DP) cells^{9, 16}, that in turn are generated when the preTCR (rearranged TCRβ paired with invariant pre-Tα) drives CD44⁽⁻⁾CD25⁽⁺⁾ DN3 cells to CD44⁽⁻⁾CD25⁽⁻⁾ DN4 cells (and then on to the DP stage) in a process called β-selection¹¹. C57BL/6 mice had an expected DN3-to-DN4 ratio of ~1.5, consistent with a normal transition through the β-selection checkpoint (Fig. 1E). However, the DN3-to-DN4 ratio of FVB/n was over twice as large, reminiscent of mice lacking a component of the preTCR (e.g. pTα^−/− mice¹¹). Moreover, DN3 cells from FVB/n mice had significantly elevated surface expression of CD25, a signatory feature of inefficient progression through the DN-to-DP transition¹¹ (Fig. 1F). Thus, FVB/n mice, that have a significantly reduced unconventional TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IEL compartment compared with C57BL/6 animals, also display inefficient developmental progression through thymic stages that lead to generation of unconventional IEL progenitors.

Weak preTCR signal strength in FVB/n mice underlies inefficient β-selection

To investigate the inefficient DN3-to-DN4 transition in FVB/n mice that appeared to correlate with reduced unconventional TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IEL development, we first assessed components of the preTCR. Intracellular TCRβ levels in DN3 cells appeared comparable between FVB/n and C57BL/6 animals (Fig. 2A). For pTα, two isoforms exist; a full-length pTα^a, and truncated pTα^b, both of which can form a preTCR and drive β-selection¹⁷. Interestingly, single cell PCR of both the DN3 and DN4 subsets revealed examples of single cells expressing pTα^a alone, pTα^b alone, or both pTα^a and pTα^b (Sup Figure S2). When the strains were compared, DN3 cells from FVB/n mice appeared to express significantly more pTα^a (but not more pTα^b), than C57BL/6 mice (Fig. 2B). It was shown that preTCR consisting of pTα^a:TCRβ is expressed at significantly lower surface levels than preTCR consisting of pTα^b:TCRβ, and that this lower surface expression results in decreased preTCR signal strength¹⁷. Consistent with this, FVB/n mice possessed a lower proportion (approaching significance) of CD71⁽⁺⁾i.c.TCRβ⁽⁺⁾ proliferating DN3 cells¹⁸ (Fig. 2C), that expressed significantly lower levels of CD5 (Fig. 2D), a recognised marker of TCR signal strength¹⁹, than similar cells from C57BL/6 mice, suggesting that inefficient β-selection may be due to weak preTCR signalling in FVB/n animals. Thus, weaker signalling during the DN-to-DP transition correlates with reduced numbers of unconventional TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IELs in FVB/n mice.

Reduced unconventional TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IELs in pTα^a-only transgenic mice

To test the idea that weaker signalling at the β-selection checkpoint and reduced generation of unconventional TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IELs are linked, we generated mice in which only a weakly signalling pTα^a-containing preTCR could be formed. pTα-intron-1 was removed from the full pTα genomic locus (to prevent splicing to pTα^b), in a 50 kb bacterial artificial chromosome (BAC), that was then used to generate pTα^a-only BAC transgenic mice on a pTα^−/− (C57BL/6) background (Sup Figure S3A). As expected, the pTα^a-only transgene largely rescued the pTα^−/−associated block in thymocyte development as assessed by comparison of thymus and spleen profiles from C57BL/6 WT, pTα^−/−, and pTα^a. pTα^−/− mice (Sup Figure S3B). However, total thymocyte number in pTα^a. pTα^−/− mice, as reflected by the DP subset, did not reach WT levels, (Fig. 3A). Consistent with this, transition through the β-selection checkpoint was markedly reduced (Fig. 3B), with a DN3:DN4 ratio of ~5 in pTα^a. pTα^−/− mice compared to ~1 in WT animals (Fig. 3C). Moreover, surface CD25 was elevated on DN3 cells from pTα^a. pTα^−/− animals, compared to WT (Fig. 3D), while newly selected proliferating CD71⁽⁺⁾ DN3 cells displayed markedly less CD5, indicative of weaker TCR signalling (Fig. 3E). Importantly, this evidence of an inefficient DN3-to-DN4 transition in pTα^a. pTα^−/− mice correlated with a notable absence of unconventional TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IELs in the small intestine (Fig. 3F) (total IEL cell yield was not significantly different between the three strains (Sup Figure S4A)). By contrast, conventional TCRαβ⁽⁺⁾CD8αβ⁽⁺⁾ IELs and TCRγδ⁽⁺⁾ IELs were present in normal proportions (Sup Figure S4B). Thus, pTα^a. pTα^−/− mice, that can only generate a pTα^a-containing preTCR that signals weakly, display inefficient transition through the β-selection checkpoint, and a significant absence of unconventional TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IELs.

Strong TCR signalling in DN cells promotes increased development of unconventional TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IELs

The above data suggest that weak TCR signalling at the β-selection checkpoint leads to a subsequently less efficient development of unconventional TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IELs. To test this idea further, we sought to increase TCR signalling in DN cells to ascertain if this would conversely increase unconventional TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IEL development. TCRαβ transgenic (tg) mice aberrantly express TCRαβ complexes that signal strongly at the β-selection checkpoint. Indeed, as well as driving DN cells to the DP stage, this strong TCR signalling is also thought to divert some DN progenitors to the γδ lineage^20,21,22. OT-II mice (C57BL/6 background), express an ovalbumin-specific MHC-II-restricted Vα2⁽⁺⁾Vβ5⁽⁺⁾ transgenic TCRαβ²³. Vα2⁽⁺⁾ (i.e. largely tg-TCR⁽⁺⁾) DN3 cells from OT-II mice express much higher levels of CD5 than Vα2⁽⁻⁾ DN3 cells, indicative of stronger TCR signalling (Fig. 4A). And in contrast to DN cells from FVB/n and pTα^a. pTα^−/− mice, Vα2⁽⁺⁾ DN cells from OT-II mice traverse the β-selection checkpoint efficiently (Fig. 4B). Importantly, on inspection of the gut of OT-II mice, a significantly increased proportion of unconventional TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IELs was observed, notably inverting the TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IEL-to-TCRαβ⁽⁺⁾CD8αβ⁽⁺⁾ IEL ratio (Fig. 4C).

TCR-tg mice express a single TCRα/TCRβ combination that may have unusual signalling characteristics. Thus, to extend these studies, we took advantage of a little-known feature of TCRδ^−/− mice; the rearrangement and expression of early TCRα transcripts induced by the strong PGK promoter used to delete the Cδ region (Sup Figure S5)^{24, 25}. We crossed TCRδ^−/− mice with pTα^−/− mice to generate TCRδ^−/−. pTα^−/− mice in which DN cells cannot express either TCRγδ or preTCR, yet can (in some cells) rearrange early TCRα (and TCRβ). Compared with pTα^−/− mice, TCRδ^−/−. pTα^−/− mice had an increased population of DN4 cells, the majority of which robustly expressed TCRβ (Fig. 5A). Unlike for TCRβ, a pan-TCRα antibody is not available. However, when antibodies for Vα2, Vα8 and Vα11 were used together over 10% of DN4 cells from TCRδ^−/−. pTα^−/− mice stained positive compared with <0.5% of DN4 cells from pTα^−/− animals (Fig. 5A). Moreover, DN cells from TCRδ^−/−. pTα^−/− mice expressed high levels of CD5 consistent with stronger TCRαβ-driven signalling (Fig. 5B). Thus, β-selection in TCRδ^−/−. pTα^−/− mice is driven solely by a broad repertoire of early-expressed TCRαβ complexes. Importantly, on inspection of the small intestine of TCRδ^−/−. pTα^−/− mice, an increased proportion of unconventional TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IELs was observed, again inverting the TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IEL-to-TCRαβ⁽⁺⁾CD8αβ⁽⁺⁾ IEL ratio (Fig. 5C). Collectively, these data support the hypothesis that TCR signal strength in DN cells at the β-selection checkpoint influences subsequent unconventional TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IEL development.

Discussion

The developmental origins of TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ intraepithelial lymphocytes have long been debated. Initially, the recognition that TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IELs, but not TCRαβ⁽⁺⁾CD8αβ⁽⁺⁾ IELs, were present in athymic mice led to suggestion of their extra-thymic generation in gut lymphoid structures called cryptopatches (CPs)⁶. Indeed, CPs were shown to contain CD25⁽⁺⁾IL-7Rα⁽⁺⁾c-kit⁽⁺⁾ progenitors that could reconstitute the T cell compartments of irradiated T cell-deficient animals²⁶. Nonetheless, that athymic mice have only 5–10% of the total TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IELs of euthymic mice conversely argued for a predominately thymic origin. The thymic generation of TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IELs was further supported by fate mapping experiments in which a GFP marker was activated by RORγt-promoter-driven Cre protein⁷. RORγt is expressed in thymic DP cells but not in their DN precursors. As all γδ T cells develop from DN cells, TCRγδ⁽⁺⁾ IELs were GFP⁽⁻⁾. By contrast, TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IELs were GFP⁽⁺⁾, suggesting their development through a DP stage⁷.

It was also recognized early that TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IELs use “forbidden” TCRβ chains that were purged from the conventional TCRαβ⁽⁺⁾ T cell pool by superantigen-driven negative selection of DP cells in the thymus²⁷. Nonetheless, despite evidence of “TCR-agonist-selection”^{8, 28}, identifying the thymic stages through which TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IEL progenitors progress has proven more problematic. Cheroutre and colleagues described a minor subset of CD8αα⁽⁺⁾ DP cells that appeared to develop as TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IELs if exposed to TCR-agonist signals⁹. Somewhat surprisingly, these “triple positive” (TP) cells then shut off CD4, CD8α and CD8β to become TCRαβ⁽⁺⁾CD5⁽⁺⁾ DN cells, before re-expressing CD8αα⁽⁺⁾ in the gut epithelium possibly under the influence of TGFβ²⁹. By contrast, the stages that precede the TP stage are less clear. As too are the reasons why TP cells survive TCR-agonist signals, rather than dying as DP cells do during TCR-agonist-driven negative selection. It is conceivable that TP cells have already entered an unconventional IEL developmental pathway, and are thus cell-intrinsically distinct from DP cells that allow them to survive agonist signals. In this regard, RhoH³⁰, and TGFβ signalling²⁹, have been implicated in differential thymic development of TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IELs versus conventional T cell subsets. Nonetheless, how unconventional IEL progenitors could adopt such a distinct gene expression profile by the TP stage, and indeed how TP cells are even generated, had not been previously elucidated.

In this study, we have shown that modulation of TCR signal strength at the thymic DN stage fundamentally impacts on the development of TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IELs; stronger TCR signalling in DN cells, as judged by CD5 surface levels and the efficiency of the DN-to-DP transition, appearing to favour TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IEL generation. As TP cells, like DP cells, are presumably derived from DN precursors as a result of (pre)TCR signalling, we speculate that stronger signalling at the DN stage favours TP generation. Unfortunately, we were unable to formally test this idea, as CD8αα-specific antibodies are not available and TL-tetramer staining did not work in our hands⁹. Nonetheless in this regard, peripheral CD4⁽⁺⁾ cells do upregulate CD8αα when activated through TCRαβ (by cross-linking antibodies) in the presence of TGFβ²⁹, the absence of which has been correlated with reduced generation of TCRαβ⁽⁺⁾CD5⁽⁺⁾ IEL precursors²⁹.

At first glance, invoking strong TCR signals in DN cells to drive generation of (CD8αα⁽⁺⁾) DP cells conflicts with the notion that such signals are required for commitment to the γδ T cell lineage^{13, 14}. Indeed, premature expression of TCRα in DN cells of TCRαβ transgenic mice was shown to promote differentiation of CD4⁽⁻⁾CD8⁽⁻⁾TCRαβ⁽⁺⁾ cells with γδ T cell-like properties^20,21,22. Nonetheless, many of these studies also reported increased numbers of TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IELs, and made obvious but perhaps incorrect links between these DN TCRαβ⁽⁺⁾ cells and IEL development³¹. However, these “γδ-wannabie” cells do not traverse the DP stage (unlike bone fide IEL progenitors), and do not rearrange their endogenous TCRα chains²⁰; something obviously required for TCRαβ⁽⁺⁾ IEL development. By way of explanation, our data now suggest that in TCRαβ⁽⁺⁾ transgenic mice at least some DN cells will transition to the DP stage as a result of stronger transgenic-TCR signalling. This could boost the TP cell to conventional DP cell ratio, which in turn would favour increased TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IEL development.

Finally, what would normally provide the stronger TCR signals in DN cells to drive TP generation in the absence of prematurely expressed transgenic TCRαβ? TCRα is reported to rearrange in a small fraction of WT DN cells³², although whether this is physiologically relevant is unclear. Instead, a candidate “strong-signalling” TCR could be preTCR^b that is generated when rearranged TCRβ binds to the truncated pTα^b isoform that lacks the pTα extracellular Ig-domain encoded by exon-2 ¹⁷. PreTCR^b was shown to signal more strongly than preTCR^a due to the higher preTCR^b surface expression levels permitted by pTα^b ¹⁷. Such stronger signalling may result in a higher proportion of DN cells becoming TP cells. Our data presented here are consistent with such a mechanism. BAC-tg mice in a pTα^−/− background, that expressed only pTα^a under the physiological pTα promoter, showed weaker than normal TCR signal strength in DN cells, a relatively inefficient DN-to-DP transition, and a reduced proportion of unconventional TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IELs.

In sum, our findings shed new light on the early thymic stages of unconventional IEL development. We demonstrate that TCR signal strength in DN cells at the β-selection checkpoint significantly influences the development of unconventional TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IELs. Stronger signalling favours TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ IEL development. By contrast, weaker signalling favours a greater contribution from conventional TCRαβ⁽⁺⁾CD8αβ⁽⁺⁾ IELs that are likely differentiated from naïve conventional CD8αβ⁽⁺⁾ T cells in the gut-associated lymphoid tissue.

Methods

All experimental protocols were performed in, and approved by, The Blizard Institute, Bart’s and The London School of Medicine, Queen Mary University of London.

Mice

C57BL/6 and FVB/n mice were purchased from Charles River Laboratories. All mice were 6–12 weeks old. Mice were bred and maintained in specific pathogen-free animal facilities at Queen Mary University of London. All experiments were performed in compliance with relevant laws and institutional guidelines and were approved by a local ethics committee.

Generation of pTα^a. pTα^−/− mice

BAC-transgenic mice were generated by the recombineering technique (http://recombineering.ncifcrf.gov)³³. In brief, a pTα locus-containing BAC (BMQ452P20) was purchased from www.ensemble.org. A GalK cassette was first amplified from a GalK plasmid using primers that contained 50 bp homology with sections of pTα intron-1;

Fwd:5′GACAGGGTTTCTCTGTGTAGCTCCGGCTGTCCT GGAACTCACTCTGAGACCAGGCTGGCCTCGAACTCAGA AATCCTGTTGACAATTAATCATCGGCA-3′;

Rev: 5′TGGGTTGTTGTGGGTGGGCGGTTGTTAGTTGGTTG CTGTCAGTCTTGGCTTGCTAA GTAGTCGTGGGCAAAGAATCAGCACTGTCCTGCTCCTT-3′.

The GalK PCR product was then inserted by homologous recombination into intron-1 and selected for in minimal broth containing galactose. Removal of intron-1 was mediated by a double-stranded oligo made by annealing two primers with 75 bp homology to the targeted regions;

Fwd:5′TGGGTCATGCTTCTCCACGAGTGGGCCATGGCTAGGA CATGGCTGCTGCTGC TTCTGGGCGTCAGGTGTCAGGCCCTACCATCA GGCATCGCTGGCACCC-3′;

Rev:5′AGGCAAACCACCAGCATGTGCTGCCTTCCATCTACCAGC AGTGTGATGGG TGGAGCCAGAGACGGAAAGGGGGTG CCAGCGATGCCTGATGGTAGGGCCT-3′.

The resulting BAC was selected for removal of the GalK gene. After sequencing, a 28 kb Spe1 fragment was used for injection into the pro-nuclei of fertilized C57BL/6 oocytes.

Tissue processing and cell isolation

For single-cell suspensions, thymus and spleen were crushed and filtered through 80μm stainless steel mesh (Sefar Ltd., UK) in fluorescence-activated cell sorting (FACS) buffer (phosphate-buffered saline (PBS) containing; 2% heat-inactivated fetal calf serum (FCS) (Life technologies); and 5 mM ethylenediaminetetraacetic acid (EDTA) (Life technologies)). For spleen, red blood cells were removed by gradient centrifiguation at 1600rpm for 25 min using 4 mL of Lymphocyte Separation Medium (Fischer). For IEL preparations, faecal material was flushed from lumen of small intestine with ice-cold PBS using a gavage needle. Fatty tissues, vasculature and Peyer’s patches were removed, followed by longitudinal opening and 60 min agitation in RPMI-1640 10% Newborn calf serum (NCS) (Life technologies) with 5 mM EDTA (Life technologies) at 37 °C. Cells were subsequently passed through an autoclaved column containing 0.7 g of nylon wool (Polysciences, USA), equilibrated with RPMI-1640 with 38 mM HEPES (Life technologies). IELs were enriched on a discontinuous Percoll gradient (40%/80% isotonic Percoll), before use and stained as described below.

Flow cytometry and cell sorting

Fluorochrome-conjugated antibodies (eBioscience or BD) were; CD3ε (145-2C11), CD4 (RM4-5), CD8α (53–6.7), CD25 (PC61), CD44 (IM7), TCRδ (GL3), TCRβ (H57–597), CD8β (H35–17.2), CD5 (53–7.3), CD69 (H1.2F3), Vα2 (B20.1), CD117 (2B8), B220 (RA3–6B2). For surface staining, cells were Fc-blocked (2.4G2; eBioscience) and stained with antibodies in FACS buffer (PBS with 2% FCS, Life Technologies) for 30 mins. Cells were then washed twice with FACS buffer using a centrifugation speed of 300 g for 5 mins. After staining, cells were resuspended in FACS buffer containing 0.5 μg/ml DAPI (Life technologies) for dead cell exclusion. For intracellular staining, cells were first stained for extracellular markers and subsequently fixed and permeabilized using the eBioscience intracellular flow kit according to the manufacturer’s protocol. The corresponding isotype control was used as a negative control. Samples were acquired using an LSR-II and analysed using Flow Jo v10.

RNA isolation, cDNA production and real-time PCR

Total RNA was extracted using the RNeasy Mini kit (QIAGEN) according to the manufacturer’s instructions. Concentration and purity was determined using the NanoDrop ND-1000 spectrophotometer (Thermo Scientific). Total RNA was reverse-transcribed into cDNA using the High-Capacity RNA-to-cDNA™ Kit (life technologies). Quantitative real-time PCR was performed using the power SYBR green PCR Master mix (life technologies) on the 7500 real-time PCR system (life technologies). Primers were designed manually and recognised intron/exon boundaries;

pTα^aFwd: 5′-GGCTCTACCATCAGGCATCGC-3′;

pTα^aRev: 5′-GGTGGTTTGCCTGGTCCTCG-3′;

pTα^bFwd: 5′-GCTCTACCATCAGGGGGAATCTTC-3′;

pTα^bRev: 5′-CGGGGGGACACAGCGG-3′.

All samples were run in triplicate and expression was normalised against the housekeeping gene GAPDH. Analysis of PCR results was performed on 7500 real-time software v2.0.6 (life technologies).

Single cell PCR

Cells were individually FAC-sorted into 96 well-plates containing 10 μl of reverse transcription mix (2% Triton-X, 10U RNAseOUT (Life Technologies), 30U MMLV-RT reverse transcriptase (life Technologies), 1% BSA and 0.5 μM of the following primers;

pTαgeneF: 5′-TAGGACATGGCTGCTGCTGC-3′;

pTαgeneR: 5′-TCCCACCCACAGAATTTGGAC-3′.

Plates were incubated for 2hr at 37 °C in a thermocycler (Biorad) and the reaction was stopped by 10 min incubation at 70 °C. Two rounds of PCR were then carried out on the cDNA. The first round of PCR consisted of denaturation at 94 °C, followed by 34 cycles of amplification (20 sec at 94 °C, 45 sec at 52 °C and 1 min at 72 °C) in a PCR mix containing 7.5U of Taq polymerase (NEB), 0.25 mM dNTPs (NEB), 1.6 mM MgCl₂ (NEB) and 0.25 mM of the pTαgeneF and pTαgeneR primers. The second round PCR was performed using 2.0 μl of the PCR product generated by the first-round PCR and consisted of a 3 min denaturation step followed by 25 cycles of amplification (20 sec at 94 °C, 45 sec at 52 °C and 1 min at 72 °C) in a PCR mix containing 6.5U of Taq polymerase, 1.6 mM MgCl₂, 0.25 mM dNTPs, and 0.25 mM of the following primers;

pTα^aF: 5′-GCTCTACCATCAGGCATCGC-3′;

pTα^aR: 5′-CTCCAGCTGTCAGGGGAATC-3′;

pTα^bF: 5′-GCTCTACCATCAGGGGAATCTTC-3′;

pTα^bR: 5′-GCAGGTACTGTGGCTGAGC-3′.

PCR products were run on a ReadyAgarose 96 Plus gel (Biorad) and PCR products were sequenced for validation.

Statistical analysis

Data are presented as mean ± s.d. A student’s t-test was used to assess statistical significance between groups. A difference was considered significant if p < 0.05.

References

Hayday, A., Theodoridis, E., Ramsburg, E. & Shires, J. Intraepithelial lymphocytes: exploring the Third Way in immunology. Nature Immunology 2, 997–1003 (2001).
Article CAS PubMed Google Scholar
Cheroutre, H., Lambolez, F. & Mucida, D. The light and dark sides of intestinal intraepithelial lymphocytes. Nature Reviews Immunology 11, 445–456 (2011).
Article CAS PubMed PubMed Central Google Scholar
Rocha, B., Vassalli, P. & Guygrand, D. Thymic and Extrathymic Origins of Gut Intraepithelial Lymphocyte Populations in Mice. Journal of Experimental Medicine 180, 681–686 (1994).
Article CAS PubMed Google Scholar
Shires, J., Theodoridis, E. & Hayday, A. C. Biological insights into TCR gamma delta(+) and TCR alpha beta(+) intraepithelial lymphocytes provided by serial analysis of gene expression (SAGE). Immunity 15, (419–434 (2001).
Google Scholar
Pennington, D. J. et al. The inter-relatedness and interdependence of mouse T cell receptor gamma delta(+) and alpha beta(+) cells. Nature Immunology 4, 991–998 (2003).
Article CAS PubMed Google Scholar
Lambolez, F. et al. Characterization of T cell differentiation in the murine gut. Journal of Experimental Medicine 195, 437–449 (2002).
Article CAS PubMed PubMed Central Google Scholar
Eberl, G. & Littman, D. R. Thymic origin of intestinal alpha beta T cells revealed by fate mapping of ROR gamma t(+) cells. Science 305, 248–251 (2004).
Article CAS PubMed ADS Google Scholar
Leishman, A. J. et al. Precursors of functional MHC class I- or class II-restricted CD8 alpha alpha(+) T cells are positively selected in the thymus by agonist self-peptides. Immunity 16, 355–364 (2002).
Article CAS PubMed Google Scholar
Gangadharan, D. et al. Identification of pre- and postselection TCR alpha beta(+) intraepithelial lymphocyte precursors in the thymus. Immunity 25, 631–641 (2006).
Article CAS PubMed Google Scholar
McDonald, B. D., Bunker, J. J., Ishizuka, I. E., Jabri, B. & Bendelac, A. Elevated T Cell Receptor Signaling Identifies a Thymic Precursor to the TCR alpha beta(+)CD4⁽⁻⁾CD8 beta⁽⁻⁾ Intraepithelial Lymphocyte Lineage. Immunity 41, 219–229 (2014).
Article CAS PubMed PubMed Central Google Scholar
Fehling, H. J., Krotkova, A., Saintruf, C. & Vonboehmer, H. Crucial Role of the Pre-T-Cell Receptor-Alpha Gene in Development of Alpha-Beta but Not Gamma-Delta T-Cells (Vol 375, Pg 795, 1995). Nature 378, 419–419 (1995).
Article CAS ADS Google Scholar
Panigada, M. et al. Constitutive endocytosis and degradation of the pre-T cell receptor. Journal of Experimental Medicine 195, 1585–1597 (2002).
Article CAS PubMed PubMed Central Google Scholar
Hayes, S. M., Li, L. & Love, P. E. TCR signal strength influences alphabeta/gammadelta lineage fate. Immunity 22, 583–593 (2005).
Article CAS PubMed Google Scholar
Haks, M. C. et al. Attenuation of gammadeltaTCR signaling efficiently diverts thymocytes to the alphabeta lineage. Immunity 22, 595–606 (2005).
Article CAS PubMed Google Scholar
Kreslavsky, T. et al. beta-Selection-Induced Proliferation Is Required for alpha beta T Cell Differentiation. Immunity 37, 840–853 (2012).
Article CAS PubMed PubMed Central Google Scholar
Mayans, S. et al. alpha beta T Cell Receptors Expressed by CD4(−)CD8 alpha beta Intraepithelial T Cells Drive Their Fate into a Unique Lineage with Unusual MHC Reactivities. Immunity 41, 207–218 (2014).
Article CAS PubMed PubMed Central Google Scholar
Barber, D. F., Passoni, L., Wen, L., Geng, L. P. & Hayday, A. C. Cutting edge: The expression in vivo of a second isoform of pT alpha: Implications for the mechanism of pT alpha action. Journal of Immunology 161, 11–16 (1998).
CAS Google Scholar
Janas, M. L. et al. Thymic development beyond beta-selection requires phosphatidylinositol 3-kinase activation by CXCR4. Journal of Experimental Medicine 207, 247–261 (2010).
Article CAS PubMed PubMed Central Google Scholar
Azzam, H. S. et al. CD5 expression is developmentally regulated by T cell receptor (TCR) signals and TCR avidity. Journal of Experimental Medicine 188, 2301–2311 (1998).
Article CAS PubMed PubMed Central Google Scholar
Bruno, L. & Fehling, H. J. & vonBoehmer, H. The alpha beta T cell receptor can replace the gamma delta receptor in the development of gamma delta lineage cells. Immunity 5, 343–352 (1996).
Article CAS PubMed Google Scholar
Fritsch, M., Andersson, A., Petersson, K. & Ivars, F. A TCR alpha chain transgene induces maturation of CD4(−)CD8(−) alpha beta(+) T cells from gamma delta T cell precursors. European Journal of Immunology 28, 828–837 (1998).
Article CAS PubMed Google Scholar
Terrence, K., Pavlovich, C. P., Matechak, E. O. & Fowlkes, B. J. Premature expression of T cell receptor (TCR)alpha beta suppresses TCR gamma delta gene rearrangement but permits development of gamma delta lineage T cells. Journal of Experimental Medicine 192, 537–548 (2000).
Article CAS PubMed PubMed Central Google Scholar
Barnden, M. J., Allison, J., Heath, W. R. & Carbone, F. R. Defective TCR expression in transgenic mice constructed using cDNA-based alpha- and beta-chain genes under the control of heterologous regulatory elements. Immunology and Cell Biology 76, 34–40 (1998).
Article CAS PubMed Google Scholar
Itohara, S. et al. T-Cell Receptor Delta-Gene Mutant Mice - Independent Generation of Alpha-Beta T-Cells and Programmed Rearrangements of Gamma-Delta Tcr Genes. Cell 72, 337–348 (1993).
Article CAS PubMed Google Scholar
Pham, C. T. N., MacIvor, D. M., Hug, B. A., Heusel, J. W. & Ley, T. J. Long range disruption of gene expression by a PGK-Neo cassette. Blood 88, 1720–1720 (1996).
Google Scholar
Saito, H. et al. Generation of intestinal T cells from progenitors residing in gut cryptopatches. Science 280, 275–278 (1998).
Article CAS PubMed ADS Google Scholar
Rocha, B., Vassalli, P. & Guygrand, D. The V-Beta Repertoire of Mouse Gut Homodimeric-Alpha Cd8+Intraepithelial T-Cell Receptor Alpha/Beta+Lymphocytes Reveals a Major Extrathymic Pathway of T-Cell Differentiation. Journal of Experimental Medicine 173, 483–486 (1991).
Article CAS PubMed Google Scholar
Cruz, D. et al. An opposite pattern of selection of a single T cell antigen receptor in the thymus and among intraepithelial lymphocytes. Journal of Experimental Medicine 188, 255–265 (1998).
Article CAS PubMed PubMed Central Google Scholar
Konkel, J. E. et al. Control of the development of CD8 alpha alpha(+) intestinal intraepithelial lymphocytes by TGF-beta. Nature Immunology 12, 312–U118 (2011).
Article CAS PubMed PubMed Central Google Scholar
Oda, H., Tamehiro, N., Patrick, M. S., Hayakawa, K. & Suzuki, H. Differential requirement for RhoH in development of TCR alpha beta CD8 alpha alpha IELs and other types of T cells. Immunology Letters 151, 1–9 (2013).
Article CAS PubMed Google Scholar
Leandersson, K., Jaensson, E. & Ivars, F. T cells developing in fetal thymus of T-cell receptor alpha-chain transgenic mice colonize gamma delta T-cell-specific epithelial niches but lack long-term reconstituting potential. Immunology 119, 134–142 (2006).
Article CAS PubMed PubMed Central Google Scholar
Mancini, S. J. C. et al. TCRA gene rearrangement in immature thymocytes in absence of CD3, pre-TCR, and TCR signaling. Journal of Immunology 167, 4485–4493 (2001).
Article CAS Google Scholar
Warming, S., Costantino, N., Court, D.L., Jenkins, N.A. & Copeland, N.G. Simple and highly efficient BAC recombineering using gaIK selection. Nucleic Acids Research 33 (2005).

Download references

Acknowledgements

We thank J. Pang and M. Rei for help and advice; and our BSU and flow facilities for technical assistance. Funding was from the Wellcome Trust (Grant Award 092973/Z/10/Z) to D.J.P.

Author information

Authors and Affiliations

Blizard Institute, Barts and The London School of Medicine, Queen Mary University of London, London, E1 2AT, UK
Capucine L. Grandjean, Nital Sumaria, Stefania Martin & Daniel J. Pennington

Authors

Capucine L. Grandjean
View author publications
You can also search for this author in PubMed Google Scholar
Nital Sumaria
View author publications
You can also search for this author in PubMed Google Scholar
Stefania Martin
View author publications
You can also search for this author in PubMed Google Scholar
Daniel J. Pennington
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

C.L.G. and D.J.P. designed the study; C.L.G., N.S. and S.M. performed experiments; C.L.G. and D.J.P. analysed the data; C.L.G. and D.J.P. wrote the paper.

Corresponding author

Correspondence to Daniel J. Pennington.

Ethics declarations

Competing Interests

The authors declare that they have no competing interests.

Additional information

Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Supplementary Figures

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Grandjean, C.L., Sumaria, N., Martin, S. et al. Increased TCR signal strength in DN thymocytes promotes development of gut TCRαβ⁽⁺⁾CD8αα⁽⁺⁾ intraepithelial lymphocytes. Sci Rep 7, 10659 (2017). https://doi.org/10.1038/s41598-017-09368-x

Download citation

Received: 28 April 2017
Accepted: 24 July 2017
Published: 06 September 2017
DOI: https://doi.org/10.1038/s41598-017-09368-x

This article is cited by

Differential expression of tissue-restricted antigens among mTEC is associated with distinct autoreactive T cell fates
- Marie-Ève Lebel
- Marie Coutelier
- Heather J. Melichar
Nature Communications (2020)

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.