Conjugates of Phthalocyanines with Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

Chernonosov, Alexander A.; Koval, Vladimir V.; Knorre, Dmitrii G.; Chernenko, Alexander A.; Derkacheva, Valentina M.; Lukyanets, Eugenii A.; Fedorova, Olga S.

doi:https://doi.org/10.1155/BCA/2006/63703

Bioinorganic Chemistry and Applications

On this page

Abstract References Copyright Related Articles

Open Access

Volume 2006 | Article ID 063703 | https://doi.org/10.1155/BCA/2006/63703

Conjugates of Phthalocyanines with Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

Alexander A. Chernonosov,^1,2,3Vladimir V. Koval,^1,2Dmitrii G. Knorre,^1,2Alexander A. Chernenko,⁴Valentina M. Derkacheva,⁵Eugenii A. Lukyanets,⁵and Olga S. Fedorova^1,2

Received20 Aug 2004

Revised01 Dec 2004

Accepted03 Dec 2004

Published16 Feb 2006

Abstract

Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II) and Al(III) were active as photosensitizers in the generation of singlet oxygen 1O2, while phthalocyanine of Co(II) promoted DNA oxidation by molecular oxygen through the catalysis of formation of reactive oxygen species (⋅2−, H2O2, OH). Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). A conjugate of Co(II)-tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence of O2 and 2-mercaptoethanol or in the presence of H2O2. Under both sensitized and catalyzed conditions, the nucleotides G13–G15 were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide. These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial regulators of gene expression and therapeutic agents for treatment of cancer.

References

D G Knorre, V V Vlassov, V F Zarytova, A V Lebedev, and O S Fedorova, Design and Targeted Reactions of Oligonucleotide Derivatives, CRC Press, Boca Raton, Fla, 1994.
A M Belikova, V F Zarytova, and N I Grineva, “Synthesis of ribonucleosides and diribonucleoside phosphates containing 2-chloro-ethylamine and nitrogen mustard residues,” Tetrahedron Letters, vol. 8, no. 37, pp. 3557–3562, 1967.
View at: Google Scholar
E Uhlmann and A Peyman, “Antisense oligonucleotides: a new therapeutic principle,” Chemical Reviews, vol. 90, no. 4, pp. 543–584, 1990.
View at: Google Scholar
H E Moser and P B Dervan, “Sequence-specific cleavage of double helical DNA by triple helix formation,” Science, vol. 238, no. 4827, pp. 645–650, 1987.
View at: Google Scholar
T Le Doan, L Perrouault, D Praseuth et al., “Sequence-specific recognition, photocrosslinking and cleavage of the DNA double helix by an oligo-[alpha]-thymidylate covalently linked to an azidoproflavine derivative,” Nucleic Acids Research, vol. 15, no. 19, pp. 7749–7760, 1987.
View at: Google Scholar
O S Fedorova, D G Knorre, L M Podust, and V F Zarytova, “Complementary addressed modification of double-stranded DNA within a ternary complex,” FEBS Letters, vol. 228, no. 2, pp. 273–276, 1988.
View at: Google Scholar
G Jori, “Far-red-absorbing photosensitizers: their use in the photodynamic therapy of tumours,” Journal of Photochemistry and Photobiology A: Chemistry, vol. 62, no. 3, pp. 371–378, 1992.
View at: Google Scholar
J D Spikes, “Phthalocyanines as photosensitizers in biological systems and for the photodynamic therapy of tumors,” Photochemistry and Photobiology, vol. 43, no. 6, pp. 691–699, 1986.
View at: Google Scholar
I E Kochevar, “Singlet oxygen signaling: from intimate to global,” Science's STKE: Signal Transduction Knowledge Environment, vol. 2004, no. 221, p. pe7, 2004.
View at: Google Scholar
B Halliwell and J MC Gutteridge, Free Radicals in Biology and Medicine, Oxford University Press, Oxford, UK, 3rd edition, 1999.
M E Vol'pin, N Yu Krainova, I V Moskaleva et al., “Transition-metal complexes as catalysts of active oxygen species formation in autooxidation reactions. 1. Cobalt and iron phthalocyanine complexes,” Russian Chemical Bulletin, vol. 45, no. 8, pp. 2000–2007, 1996.
View at: Google Scholar
P N Borer, “Optical properties of nucleic acids, absorption and circular dichroism spectra,” in Handbook of Biochemistry and Molecular Biology: Nucleic Acids, G D Fasman, Ed., vol. 1, pp. 589–595, CRC Press, Cleveland, Ohio, 3rd edition, 1975.
View at: Google Scholar
V V Koval, A A Chernonosov, T V Abramova et al., “Photosensitized and catalytic oxidation of DNA by metallophthalocyanine-oligonucleotide conjugates,” Nucleosides, Nucleotides & Nucleic Acids, vol. 20, no. 4–7, pp. 1259–1262, 2001.
View at: Google Scholar
C G Hatchard and C A Parker, “A new sensitive chemical actinometer. II. Potassium ferrioxalate as a standard chemical actinometer,” Proceedings of the Royal Society of London. Series A, Mathematical and Physical Sciences, vol. 235, no. 1203, pp. 518–536, 1956.
View at: Google Scholar
A M Maxam and W Gilbert, “Sequencing end-labeled DNA with base-specific chemical cleavages,” Methods in Enzymology, vol. 65, no. 1, pp. 499–560, 1980.
View at: Google Scholar
V V Koval, A A Chernonosov, T V Abramova, T M Ivanova, O S Fedorova, and D G Knorre, “The synthesis of a cobalt(II) tetracarboxyphthalocyanine-deoxyribooligonucleotide conjugate as a reagent for the directed DNA modification,” Russian Journal of Bioorganic Chemistry, vol. 26, no. 2, pp. 104–110, 2000.
View at: Google Scholar
J Stubbe and J W Kozarich, “Mechanisms of bleomycin-induced DNA degradation,” Chemical Reviews, vol. 87, no. 5, pp. 1107–1136, 1987.
View at: Google Scholar
P T Henderson, D Jones, G Hampikian, Y Kan, and G B Schuster, “Long-distance charge transport in duplex DNA: the phonon-assisted polaron-like hopping mechanism,” Proceedings of the National Academy of Sciences of the United States of America, vol. 96, no. 15, pp. 8353–8358, 1999.
View at: Google Scholar
A L Lehninger, D L Nelson, and M M Cox, Principles of Biochemistry, Worth, New York, NY, 2nd edition, 1993.
O S Fedorova, A P Savitskii, K G Shoikhet, and G V Ponomarev, “Palladium(II)-coproporphyrin I as a photoactivable group in sequence-specific modification of nucleic acids by oligonucleotide derivatives,” FEBS Letters, vol. 259, no. 2, pp. 335–337, 1990.
View at: Google Scholar
A S Boutorine, D Brault, M Takasugi, O Delgado, and C Hélène, “Chlorin-oligonucleotide conjugates: synthesis, properties, and red light-induced photochemical sequence-specific DNA cleavage in duplexes and triplexes,” Journal of the American Chemical Society, vol. 118, no. 40, pp. 9469–9476, 1996.
View at: Google Scholar
D Magda, M Wright, R A Miller, J L Sessler, and P I Sansom, “Sequence-specific photocleavage of DNA by an expanded porphyrin with irradiation above 700 nm,” Journal of the American Chemical Society, vol. 117, no. 12, pp. 3629–3630, 1995.
View at: Google Scholar

Copyright

Copyright © 2006 Alexander A. Chernonosov et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

PDF Download Citation Order printed copies

Views

283

Downloads

943

Citations