Ethics statement

All procedures were performed in accordance with Statutory Instrument No. 566 of 2002 (Amendment of Cruelty to Animals Act, 1876). All experiments were approved by the Animal Research Ethics Committee of Trinity College Dublin and carried out under licence B100/3533 issued by the Department of Health to KJM.

In situ hybridisation

Digoxigenin-labelled antisense cRNA probes for in situ hybridisation of Elfn1 were designed to encompass a section of coding sequence and 3′UTR >500bp in length. Briefly this involved TA cloning of PCR products into the TOPO vector (Invitrogen) and simultaneous synthesis and Dig-labelling of RNA transcripts from linearised vector using T7- or Sp6- RNA polymerase. Detailed information on probes is available upon request.

In situ hybridisation was carried out on vibratome-sectioned C57Bl6 mouse brains (Jackson Laboratories). For P0, brains were dissected out prior to immersion in 4% paraformaldehyde-PBS (PFA) at 4°C. Fixed brains were embedded in 3% agarose and 70 µm sections were obtained on a vibratome (VT1000S Leica). Sections were washed twice in PBST (PBS containing 0.1% Tween-20), permeabilised in RIPA buffer (150 mM NaCl, 50 mM Tris-HCl pH 8.0, 1 mM EDTA, 1% Nonidet-P40, 0.5% sodium deoxycholate, 0.1% SDS) and postfixed in 4% PFA and 0.2% gluteraldehyde. Hybridisation was performed in a humidified environment overnight at 65°C with 1 µg/ml labeled probe in hybridisation buffer (50% formamide, 5X SSC pH 4.5, 1% SDS, 50 µg/ml yeast tRNA, 50 µg/ml heparin). Posthybridisation washes were completed at 65°C using solution I (50% formamide, 5X SSC pH 4.5, 1% SDS) and solution III (50% formamide, 2X SSC pH 4.5, 0.1% Tween-20) and at room temperature using TBST (TBS containing 1% Tween-20). Brain sections were incubated for >1 hr in blocking buffer (TBST, 10% heat-inactivated sheep serum). Immunodetection was carried out in blocking buffer at 4°C overnight using a phosphatase conjugated anti-digoxigenin antibody (Roche) at a 1∶2000 dilution. Following antibody incubation extensive TBST washes were performed. Sections were equilibrated in NTMT (100 mM Tris-HCl pH 9.5, 100 mM NaCl, 50 mM MgCl₂, 1% Tween-20) prior to colourimetric detection using 2 µl/ml NBT/BCIP (Roche) in NTMT. Sections were mounted on Superfrost glass slides (VWR international) and analysed with an Olympus IX51 microscope.

Genotyping of mice

Approximately 3 mm of fresh tail tissue was digested in 200 µl Boston Buffer (50 mM Tris pH 8.0, 50 mM KCl, 2.5 mM EDTA, 0.45% NP40, 0.45% Tween20) with 14-22 mg/ml Proteinase K overnight at 56°C. 1 µl was used as template for PCR with the following primers ; Elfn1forward (5′ TGCAGCAGAGAGTACTTCAG 3′), Elfn1reverse (5′ TCTCACACACCGAGAGCTTG 3′), LacZreverse (5′ GTCTGTCCTAGCTTCCTCACTG 3′).

Immunohistochemistry

Newborn (P0) mice were collected on day of birth and decapitated. Brains were collected and dissected in ice-cold PBS before fixation at 4°C for 4–24 hours in either 4% paraformaldehyde (PFA) or 2% PFA;0.2% glutaraldehyde. Fixed brains were embedded in agarose (Sigma), 4% w/v, in PBS. Free-floating sections (50–70 µm) were collected using a vibrating microtome (Leica VT1000S) and washed twice for 10 minutes each, in PBS containing 0.2% triton X-100. Sections were then incubated in blocking buffer (10% normal serum in PBS) for 1 hour at room temperature, with gentle agitation. Incubation in primary antibody was carried out in PBS at 4°C with gentle agitation, for 24–48 hours. After removal of primary antibody, sections were washed three times for 10 minutes each in PBS at room temperature. Sections were then incubated for 2–4 hours in the dark with a fluorescently tagged secondary antibody, diluted in PBS. This was followed by two washes in PBS of 10 minutes each, and a 10 second incubation in 4′,6-diamidino-2-phenylindole (DAPI) diluted 1∶5000 in dH₂O. Sections were washed briefly in PBS and mounted onto slides with Aqua Polymount (Polysciences Inc.). Results were viewed with an epifluorescence microscope (Zeiss Axioplan2, Carl Zeiss Ltd. UK) or a laser scanning confocal microscope (Leica, DMRE). Primary antibodies used in this study included pan-Elfn (anti-Elfn2; Sigma HPA000781; 1∶50), anti-Ctip2 (Abcam 25B6; 1∶250), anti- neurofilament (DSHB 3H2; 1∶250), anti-somatostatin (Millipore MAB354, 1∶50), anti-Parvalbumin (Swant 235; 1∶1000), anti-β-galactosidase (MP Biomedicals 08559762; 1∶10,000) and anti-substance P (Chemicon MAB356; 1∶125). Quantitative analysis of Elfn1 expression patterns was performed on 3D confocal fluorescence image stacks using the cell counter plugin in ImageJ. Counts were obtained from three sections and the mean count calculated.

Animal Husbandry

Mice were maintained and bred in a 12 hr light/12 hr dark cycle, in a specific pathogen free unit. Mice used for experiments was an inbred strain of C57BL/6JolaHsd (Harlan) and a strain of C57BL/6 mice with a complete deletion of the Elfn1 coding region obtained from KnockOut Mouse Project (KOMP).

Behavioural analyses

All behavioural tests within an experiment were carried out at the same time of day (either 9am-1pm or 2–4pm). Only male mice were tested and were handled for 3 days prior to each behaviour test. Animals were brought to the test room 15 minutes before each experiment to allow habituation to the surroundings.

Wire-hang test

To evaluate muscle strength and co-ordination in Elfn1^−/− and Elfn1^+/− mice, front- and hind- paw strength was evaluated on the wire-hang test. The apparatus consisted of a horizontal steel wire (26 cm long, 0.2 cm diameter), suspended between 2 wooden poles (19.5 cm high) above a padded surface. The test consisted of 3 one-minute trials. On each trial the mice were suspended from the wire by the front 2 paws only. The mice were released and any mouse that crossed the wire to the poles at either end was deemed successful. The length of time taken to reach a pole was recorded.

Open-field test

The first set of open field tests were conducted in 2 rectangular plastic boxes (30 cm×50 cm×18 cm) and (34 cm×60 cm×20 cm) with open tops and a grid marked out on the floor. The smaller box contained a grid consisting of 15 squares (10 cm×10 cm each) and was black in colour. The larger box contained 18 squares (9.5 cm×11 cm each) and was cream in colour. Boxes were placed on a table and against a wall in the behaviour room, away from direct fluorescent lighting. Activity measurements involved manual observation of grid line crosses with a counter. Immediately after placement of a mouse in the field, the number of line crosses were noted over 3 minutes. 16 mice were tested, 8 heterozygous and 8 homozygous mutant at 4–5 months old. Testing was carried out on consecutive days in the same box to observe habituation. Further testing in the second open-field box was carried out to evaluate novelty-induced behaviour.

A second cohort of mice were tested in a new open field area with video tracking equiptment and activity was analysed using EthoVision. The open field box was cream in colour, and placed within a white circular tank (60 cm in height) above which the video camera was positioned. This environment was more exposed and more brightly lit than in the previous experiment. Ten mice of each genotype (−/− and +/−) were tested and distance travelled and zone preference (peripheral or centre) were recorded over 10 minutes in an open field box (34 cm×53 cm×18 cm). Testing was carried out on consecutive days in the same box to observe habituation behaviours.

Drug Administration

Amphetamine was dissolved in saline and injected intraperitoneally. Two concentrations were used, 0.5 mg/kg and 2 mg/kg. Saline solutions were administered to control anmals. Animals were injected 15 minutes before testing in the open field (as detailed above).

Seizure observation

Mice were placed in an empty cage with clean litter and observed for seizure behaviour over a 3 minute time period [42]. Two genotypes were assessed, Elfn1^−/− mice and Elfn1^+/− and mice were aged 6–7 months old. Length of time in seconds was noted for each seizure from the first clonus behaviour to when the mouse regained motor control.

Seizures were described using a modification of Racine's seizure scoring system [43] by Croll et al. [44]. In this paper, Croll and colleagues attribute scores from 1–8 with increasing severity of the seizure. A score of 1 represented freezing or staring, 2 represented nodding, gnawing, facial atomatisms, or mild tremors, 3 represented unilateral clonus, 4 represented bilateal forelimb clonus, 5 represented severe seizures with prolonged loss of postural control or prolonged tonus, 6 represented status epilepticus defined as 10 minutes or more of continous or closely spaced seizures with no return to normal behaviour, 7 represented status epilepticus which included a stage 5 seizure, and 8 represented seizure-induced death.

Data analysis

Group values are means and comparisons were performed using Student's t-test to determine the significance of differences between the two groups using GraphPad. Results were considered significant if p<0.05. Post-hoc analysis of the motor strength and coordination results was carried out using Fisher's exact test.

Characterisation of the Elfn1 knockout mouse line

We obtained an Elfn1 knockout mouse line from the Knockout Mouse Project [45]. Successful deletion of Elfn1 and replacement with the β-galactosidase (β-gal) coding sequence was confirmed, using polymerase chain reaction (PCR) of genomic DNA (Figure 1).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 1. Elfn1 targeted allele.

(A) Schematic of the targeting vector and the Elfn1 locus (adapted from the Knockout Mouse Project (KOMP); null allele targeting strategy (www.velocigene.com/komp/detail/10112). The full coding sequence is contained in exon 2, and this region is replaced by the expression-selection cassette. LacZ, β-galactosidase coding sequence; Neo^r, neomycin phophotransferase; red triangles represent loxP sites. Genotyping primers are represented by half arrows. (B) PCR genotyping of genomic DNA from Elfn1^+/−, wildtype and Elfn1^−/− mice. Resultant PCR product sizes are 830bp (wildtype) and 385bp (Elfn1-targeting vector fragment).

https://doi.org/10.1371/journal.pone.0080491.g001

The reliability of the β-gal reporter in the Elfn1 knockout mouse was investigated by comparing the expression of β-gal in Elfn1 heterozygous mice with Elfn1 in situ hybridisation results obtained from wildtype mice, both at P0. β-gal expression showed the same overall patterns as those obtained by in situ hybridisation, with strong expression observed in the globus pallidus, ventral pallidus, septal nuclei and in discrete nuclei within the habenula (Figure 2). Immunoreactivity was also evident in a subset of cells in the hippocampus and the cortex, as well as the diagonal band of Broca, islands of Calleja and amygdala (Figure 2). In situ hybridisation data from the Allen Brain Atlas showed that the regional and cell-type specificity of Elfn1 expression is maintained in adults (Figure S1).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 2. β-gal immunohistochemistry replicates Elfn1 in-situ hybridisation staining patterns.

Comparative coronal sections of β-gal immunoreactivity in an Elfn1^+/− mouse brain and in situ hybridisation staining using an Elfn1 probe in a wildtype brain, both at P0. (A,B) Strong staining is evident in the dorsal MHb and the central region of the LHb. Scattered cells in the cortex and hippocampus are also observed, in a layer-specific manner in hippocampus, with particularly strong staining in the CA1 region. (C,D) Strong staining of Elfn1-positive cells are identified with both methods in the globus pallidus and ventral pallidum, with intense staining specifically in the lateral cells of the GP. (E,F) The amygdala, piriform cortex, and the caudal region of the globus pallidus exhibit comparable staining. (G,H) Intense staining in the medial septum, and to a lesser extent in the DBB, is evident. The forming Islands of Calleja also show staining with both methods of Elfn1 detection. amy, amygdala; CA1, CA1 region of the hippocampus; ctx, cortex; DBB, diagonal band of Broca; GP, globus pallidus; hc, hippocampus; ICj; islands of Calleja; LH, lateral hypothalamus; LHb, lateral habenula; MHb, medial habenula; MS, medial septum; Pir, pirform cortex; VP, ventral palidum. Scale bar: 300 microns.

https://doi.org/10.1371/journal.pone.0080491.g002

Elfn1 expression in interneurons of the hippocampus and cortex

In the hippocampus at P0, Elfn1 expression was located in the strata oriens, radiatum, lacunosum moleculare and in scattered cells in the hilus of the dentate gyrus (Figure 2). A recent study of Elfn1 expression in the hippocampus found co-localisation with somatostatin (SST)-positive interneurons at P14, where 96% of Elfn1 containing cells also contained SST [41]. In this study, double-labeling with antibodies for β-gal and SST at P0 similarly identified co-expression of SST in Elfn1-positive interneurons in the hippocampus (data not shown). In the adult hippocampus, expression of Elfn1 can be seen in the strata oriens, radiatum and lacunosum moleculare (Figure 3A,C). Furthermore, we identified subsets of Elfn1-expressing cells in the pyramidal cell layer of the CA1 region and the granule cell layer of the dentate gyrus (Figure 3A,B).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 3. Elfn1 expression in the hippocampus and cortex.

(A,B) B shows a close-up of the CA1 region in A. In the adult hippocampus, the β-gal reporter is expressed in the so, pyr, sr and lm layers and also the granule cell layer (A; open arrowheads) and hilus of the dentate gyrus. Double immunoreactivity with β-gal and SST showed co-expression in the so, sr and hilus of the dentate gyrus. Co-expression in the stratum oriens at CA1 occurred in cells with a horizontal orientation (B; arrows) and small vertically orientated cells in the pyramidal cell layer are negative for SST staining (B; closed arrowheads). (C,D) A small number of cells (0.9%) co-labelled for β-gal and PV and were found in so, pyr, sr and gcl (C; open arrowheads) of the dentate gyrus. (D) Close-up of the CA1 region shows double labelling of β-gal and PV in a number of small cells located in the pyramidal cell layer (closed arrowheads). (E) Quantification of the number of cells in each layer of the adult somatosensory cortex that label for both β-gal and SST and cells that express β-gal only. (F,G) Double immunofluorescent staining for β-gal and SST (F) and β-gal and PV (G) across the 6-layered adult somatosensory cortex. (H) Close up of layers 1 and 2/3 in F showing β-gal containing cells that do not express SST, with a smaller cell body than the surrounding double-labelled cells (closed arrowheads). (I) A small number of cells co-express β-gal and PV in the cortex (arrow). (J,K) β-gal-positive cells are most abundant in layer III of the piriform cortex, and in scattered cells in the pyramidal-rich layer II (J; arrows). 77% of β-gal-containing cells were positive for SST while only 3% contained PV. ctx, cortex; CA1, CA1 region of the hippocampus; DG, dentate gyrus; gcl, granule cell layer of the dentate gyrus; so, stratum oriens; sr, stratum radiatum; lm, lacunosum-moleculare; PV, Parvalbumin; Pir, piriform cortex; pyr, pyramidal cell layer; SST, somatostatin.

https://doi.org/10.1371/journal.pone.0080491.g003

In the hippocampus, 64% of cells expressing Elfn1 also contained SST (n = 82/128); the majority of these cells were localised in the stratum oriens and the hilus of the dentate gyrus (Figure 3A). Cells expressing both Elfn1 and SST in the stratum oriens and hilus had a horizontal orientation (Figure 3A,B), as previously observed at P7 by Sylwestrak and Ghosh (2012). Double immunohistochemistry revealed that 11% of Elfn1-expressing cells also contained parvalbumin (PV); these were localised in the stratum oriens, pyramidal cell layer, stratum radiatum and the granule cell layer of the dentate gyrus (Figure 3C,D). Most of these cells displayed a vertical orientation with a comparatively small cell body size (Figure 3B,D).

In the neocortex and piriform cortex at P0, Elfn1-expressing cells were distributed unevenly across layers, with highest concentration in layers 4 and 5, and less expression in layers 2 and 3, while only a small number of cells were observed in layers 1 and 6 (Figure S2). In the 3-layer piriform cortex, Elfn1-expressing cells appeared mainly resticted to layer 3 and the endopiriform cortex. A small number of positive cells could also be seen in layer 1, and the pyramidal cell-rich layer 2 (Figure S2).

Quantitative analysis of Elfn1 expression in the adult cortex revealed that the highest number of Elfn1-containing cells localise to layer 5, layers 2–3 and layer 4. Only a small number of cells in layers 1 and 6 express Elfn1 (Figure 3E). Co-localisation analyses revealed that 77% of Elfn1-expressing cells also contained SST (n = 287/373), but the proportion of SST co-expressing cells varied by layer. In particular, layer 5 contained the highest proportion of Elfn1 and SST co-expressing cells (Figure 3E). Only 0.9% of Elfn1-expressing cells in cortex contained PV (Figure 3G,I). The remaining 22.1% of Elfn1-expressing cells express neither SST nor PV and were highly concentrated in layers 2–3. Interestingly, the cell bodies of these cells appear smaller than the surrounding Elfn1 and SST co-expressing interneurons (Figure 3H).

In the piriform cortex, 77% of Elfn1-positive cells contained SST and 3% contained PV (Figure 3J,K). While the majority of cells expressing Elfn1 were mainly resticted to layer 3, a small subset of Elfn1-expressing cells localised to the pyramidal cell-rich layer 2. The cell bodies of these cells appear smaller in size than the surrounding SST- and Elfn1-containing interneurons (Figure 3J).

Elfn1 expression in subcortical structures

Habenula.

Immunolabelling for β-gal was evident throughout the rostrocaudal extent of the habenula, where it was restricted to the dorsal part of the medial habenula and in scattered cells of the lateral habenula (Figure 4A–C). In the rostral portion of this structure, labelled cells were found in the dorsolateral medial habenula, and were absent from the LHb (Figure 4A). More caudally, expression of β-gal was further restricted to a discrete subset of cells in the dorsal-most region of the MHb, while a small number of scattered positive cells became evident in the central part of the LHb (Figure 4B). Further caudally, there were no labelled cells in the MHb and expression appeared to be localised only to the ventral region of the LHb, surrounding the fasciculus retroflexus (Figure 4C).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 4. Elfn1 expression in subcortical structures of the mouse brain.

(A–C) The β-gal reporter is expressed throughout the rostrocaudal extent of the habenula. In a rostral coronal section (A) staining is limited to the dorsolateral MHb and absent from the LHb. Further caudally staining is restricted to a smaller subset of cells in the dorsolateral MHb, and in scattered cells of the central LHb (B). In a caudal-most section, β-gal staining is absent from the MHb, and a few positive cells are located in the ventral LHb at the fasciculus retroflexus (C). (D) GAD67 staining is localised to the stria medullaris, and the lateral habenula. There is no overlap in β-gal and GAD67 staining in the MHb. (E) β-gal expression is evident in the medial (MeA), basomedial (BMA) and basolateral amygdala (BLA). Scattered cells in the central (CeA) are also positive for β-gal. Double immunoreactivity with β-gal and SST antibodies identify that expression of these two proteins are largely in separate regions of the amygdala. (F) A magnified confocal image of (E) shows that βgal-positive cells do not contain SST. (G,H) β-gal is expressed throughout the rostrocaudal extent of the globus pallidus. In a rostral section of the GP there is a strong lateral to medial gradient (G) and staining is also evident thoughout the more elongated structure in caudal sections (H). (I) Cells positive for β-gal do not colocalise with cells expressing SST in the globus pallidus. (J) β-gal staining is not observed in the entopeduncular nucleus which is highly immunopositive for Substance P (SP). (K–M) β-gal is also expressed in the medial septum (MS), diaganol band of Broca (DBB), septofimbrial nucleus (SFi) and in the islands of Calleja (ICj). Amy, amygdala; EP, entopeduncular nuleus; FR, fasciculus retroflexus; GP, globus pallidus; lHb, lateral habenula; mHb, medial habenula.

https://doi.org/10.1371/journal.pone.0080491.g004

It had previously been noted that there are no GABAergic cells in the MHb [46] and in this study, double staining for GAD67 and β-gal showed no cellular overlap (Figure 4D). Therefore, in the MHb Elfn1 is not expressed in interneurons.

ELFN1 localisation to axons of the fasciculus retroflexus, the lateral IPN and the substantia nigra pars compacta

We carried out immunohistochemistry using a pan-ELFN antibody that recognises both ELFN1 and ELFN2, but cannot differentiate between the two (Sigma HPA000781). Unfortunately, widespread expression of ELFN2 in the mouse brain prohibited the direct identification of ELFN1 protein localisation. However, the Elfn1 knockout mouse allowed for the comparison of pan-ELFN immunoreactivity in Elfn1^−/− and Elfn1^+/− mice. Loss of staining in the Elfn1^−/− mouse identified regions of ELFN1 protein localisation.

Elfn1^+/− coronal brain sections exhibited strong pan-ELFN immunoreactivity in the fasciculus retroflexus, the lateral IPN and the substantia nigra pars compacta that was absent in Elfn1^−/− mice (Figure 5). There was no Elfn1 RNA in situ hybridisation staining in any of these regions at P0 and therefore we conclude that ELFN1 protein is localised to axons of the fasciculus retroflexus, the lateral subnucleus of the IPN and in axons innervating the SNc.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 5. ELFN1 localises to axons of the lateral IPN, the substantia nigra pars compacta and the fasciculus retroflexus.

Pan-ELFN positive staining is visible in the IPL and SNc of the Elfn1^+/− (A) but not in Elfn1^−/− brain (B). In situ hybridisation with an Elfn1 probe in this region shows that Elfn1 is not expressed by cells in the SNc or the IPL at P0 (C). (D) In the Elfn1^+/− brain at P0, the pan-ELFN antibody displays strong axonal-like staining in the core of the fasciculus retroflexus (FR). (E) pan-ELFN antibody staining is absent from the FR in the Elfn1^−/− brain. (F) Elfn1 in situ hybridisation shows that Elfn1 is not expressed by cells in the FR. FR, fasciculus retroflexus; IPL, lateral subnucleus of the interpeducular nucleus; RMC, Red nucleus magnocellular part; SNc, substantia nigra pars compacta.

https://doi.org/10.1371/journal.pone.0080491.g005

Number and distribution of Elfn1-positive cells in Elfn1^−/− mice

The β-gal staining patterns in Elfn1^+/− and Elfn1^−/− mice were compared in coronal sections of mouse brain at P0, and no gross morphological differences were detected. In all regions of Elfn1 expression, the pattern and abundance of immunoreactive cells appeared normal in the homozygous mutant (Figure 6; n = 4 of each genotype)

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 6. Phenotypic analysis of the Elfn1^−/− mouse brain at P0.

β-gal staining patterns in coronal sections of the Elfn1^+/− (A,C,E,G) and Elfn1^−/− (B,D,F,H) show comparable patterns indicating no obvious morphological phenotype in the Elfn1 mutant brain (n = 4). (I–R) Neurofilament staining patterns in Elfn1^+/− (I,K,M,N,Q) and Elfn1^−/− (J,LN,P,R) show no apparent abnormality in connectivity (n = 4). FR, fasciculus retroflexus; GP, globus pallidus; Hc, hippocampus; IPN, interpeduncular nucleus; LHb, lateral habenula; MHb, medial habenula; MS, medial septum; SFi, septofimbrial nucleus; SM, stria medullaris; VP, ventral pallidum.

https://doi.org/10.1371/journal.pone.0080491.g006

Gross connectivity in Elfn1^−/− mice

Neuronal processes were immunostained with a neurofilament antibody and comparable sections in Elfn1^+/− and Elfn1^−/− mice were analysed. No gross connectivity abnormality was identified (Figure 6; n = 4 of each genotype). Particular focus on the stria medullaris and fasciculus retroflexus revealed normal innervation patterns in the habenula and the interpeduncular nucleus (Figure 6M-R).

Seizures in Elfn1^−/− mice

Twelve Elfn1^−/− animals have been witnessed having seizures during routine cage changes. These animals have been aged between 4 and 9 months old. Seizures have ranged from a score of 2 to a score 5 of the modified Racine seizure scoring system [43], [44] with one animal losing postural control during the seizure, and another displaying rapid running and jumping. Two more mice from the behavioural study (see below) exhibited a seizure (both 3 months old, score of 4 on the Racine scoring system). However, both these mice had received amphetamine, complicating interpretation.

In a three-minute observation test [42] two out of eight Elfn1^−/− mice and zero out of eight Elfn^+/− mice displayed seizures when placed in a clean and empty cage. All mice were 6–7 months old. One seizure represented a score of 4 in the modified Racine seizure scoring system with freezing immediately upon placement in the new cage, followed by bilateral forelimb clonus that lasted 33 seconds before motor control was regained. The second observed seizure also began with motor arrest, followed by head-bobbing and mild shaking for 22 seconds. This seizure corresponds to a score of 2 in the modified Racine seizure scoring system.

Reduced motor coordination and strength

In the wire-hang test, Elfn1^−/− mice were less successful than the Elfn1^+/− mice at completing the task (62.5% vs 91.67%, n = 8 mice/genotype; 3 trials per animal; p = 0.0363) (Figure 7A). Moreover, when successful trials were compared across the 2 groups of mice, the time taken to reach a pole was significantly longer for the Elfn1^−/− mice (18.47 s±3.13, n = 15) than the Elfn1^+/− mice (10.0 s±1.02, n = 22; p = 0.0054) (Figure 7B).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 7. Reduced motor performance and thigmotaxis behaviour in Elfn1^−/− mice.

(A) Elfn1^+/− mice completed a wire hang trial with a success rate of 91.67% and Elfn1^−/− mice were only successful in 62.5% of the trials (n = 8/genotype; 3 trials per mouse; p = 0.0363). (B) The time taken to complete a successful trial was analysed and Elfn1^−/− mice took considerably longer to reach a pole (p = 0.0054). Data expressed as mean±SEM (n = 22 for Elfn1^+/− and n = 15 for Elfn1^−/− mice). Student's t test was used to compare the means. (C,D) Percentage of total time spent in the centre zone on day 1 (C) and day 2 (D). Elfn1^−/− mice spent more time in the centre zone than Elfn1^+/− mice on both days (p = 0.0031 for day 1, and p = 0.0496 for day 2; n = 10/genotype). (E,F) Percentage of total distance travelled in the centre zone on day 1 (E) and day 2 (F). Elfn1^−/− mice travelled further than Elfn1^+/− mice in the centre zone on both days (p = 0.023 for day 1 and p = 0.0076 for day 2). Student's t test used to identify statistical difference between the groups.

https://doi.org/10.1371/journal.pone.0080491.g007

Post hoc analysis revealed that all successful trials in heterozygous animals were completed with the use of 4 limbs. However, in 4 of the 15 successful trials carried out by Elfn1^−/− mice, only the forelimbs were used to reach the poles after initial attempts to raise the hindlimbs onto the wire failed. In the 9 failed trials carried out by Elfn1^−/− mice, the animals did not manage to raise their hindlimbs onto the wire, and subsequently fell off. These findings collectively indicate that Elfn1^−/− mice exhibit reduced motor strength and/or coordination.

Reduced thigmotaxis in Elfn1^−/− mice

During open field behavioural testing, Ethovision analysis revealed that Elfn1^−/− mice exhibited a reduction in wall-hugging behaviour or thigmotaxis. The percentage of total time spent in the centre of the open field was significantly higher in Elfn1^−/− mice (25.34±1.88, n = 10) compared with the Elfn1^+/− mice (16.12±1.95, n = 10; p = 0.0031) (Figure 7C). The percentage of total distance travelled in centre of the open field was also significantly higher for Elfn1^−/− mice (28.15±1.60, n = 10) than for Elfn1^+/− mice (21.82±1.99, n = 10) (p = 0.023; Figure 7E). This behavioural phenotype was observed again on day 2 of testing with Elfn1^−/− spending more time in the centre zone (21.86±1.35 vs 15.13±2.90 n = 10/genotype; p = 0.0496) (Figure 7D). Locomotion in the centre zone also remained significantly higher in Elfn1^−/− mice (28.12±1.30 vs 20.11±2.33, n = 10/genotype; p = 0.0076) (Figure 7F).

Elfn1^−/− mice exhibited hyperlocomotion

Activity behaviour was examined in two cohorts of male mice. The first cohort contained eight mice of each genotype (homozyous mutant and heterozygous), aged 3–4 months and the second contained ten mice of each genotype, aged 2–3 months. For the first trial of open field testing (Experiment 1), mice from cohort number 1 were placed in a rectangular box with a grid marked out on the floor. The number of line crosses was noted over 3 minutes, and taken as an indication of activity. Student's t test was used to determine the significance of differences between the two groups, and demonstrated increased locomotion in Elfn1^−/− mice (132.5±10.11, n = 8) compared with the Elfn1^+/− mice (97.88±5.75, n = 8; p = 0.01) (Figure 8A). The following day, locomotor activity was measured again in the same field to analyse activity after habituation. The Student's t test analysis showed that while activity levels decreased across both genotypes, the mean level of activity remained higher in Elfn1^−/− mice (90.13±13.32, n = 8) compared with the Elfn1^+/− mice (67.38±5.62, n = 8; Figure 8B) but did not reach statistical difference (p = 0.138). Analysis of activity in a new open field environment confirmed significantly higher activity in Elfn1^−/− mice (120.1±12.55 vs 71.13± 4.53, n = 8; p = 0.0025) (Figure 8C).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 8. Hyperlocomotion of Elfn1^−/− mice.

(A–E) Experiment 1. (A) The number of crosses on day 1 of open field testing was significantly higher for Elfn1^−/− mice than in Elfn1^+/− mice (p = 0.01; n = 8/genotype). (B) On day 2, in the same open field, there was no significant difference between the groups (p = 0.138) but the mean number of crosses remained higher for Elfn1^−/− mice (90.13±13.32) versus Elfn1^+/− mice (67.38±5.62; n = 8/genotype). (C) Introduction to a novel environment again confirmed a higher number of crosses in Elfn1^−/− mice versus Elfn1^+/− mice (p = 0.0025; n = 8/genotype). (D) Graph shows the number of crosses before and after 0.5 mg/kg AMPH for each mouse in experiment 1 (n = 8/genotype). Elfn1^+/− (white circles), Elfn1^−/− (black circles). (E) The mean percentage distance travelled by Elfn1^+/− and Elfn1^−/− mice after 0.5 mg/kg. Student's t test p value = 0.0159. (F–K) Experiment 2. (F) On day 1, statistical analysis revealed no significant difference between the groups however, the mean distance travelled by Elfn1^−/− mice was greater than by Elfn1^+/− mice (5701±278.8 for Elfn1^−/− and 5108±222.4 for Elfn1^+/−, n = 10/genotype; p = 0.1141). (H) On day 2, in the same open field, Elfn1^−/− mice travelled a significantly greater distance than Elfn1^+/− mice (p = 0.0381; n = 10/genotype). (G) On day 1, the mean distance travelled by Elfn1^−/− mice remained higher than for Elfn1^+/− mice over the 10 minutes, and a significant difference between the genotypes is evident in the final 2 minute bin (p = 0.0021; n = 10/genotype). (I) On day 2, a significant difference between groups in the mean distance travelled is identified at the 4–6 minute and 8–10 minute time bins (p = 0.0024 and p = 0.0067 respectively). All data expressed as means, and Student's t test used to analyse statistical difference betwen the groups. Post-hoc analysis is not corrected for multiple testing. (J) Graph depicts differences in distance travelled by each mouse when administered saline and 2.0 mg/kg AMPH in experiment 2 (n = 10 Elfn1^+/−, n = 9 Elfn1^−/−). (K) The mean percentage distance travelled by Elfn1^+/− and Elfn1^−/− mice after 2.0 mg/kg of AMPH. Student's t test p value = 0.0029 for 2.0 mg/kg.

https://doi.org/10.1371/journal.pone.0080491.g008

When the activity trials from the three experiments were accumulated, providing 24 activity values for each genotype, a Student's t test for genotype differences confirmed that Elfn1^−/− mice have substantially higher activity levels (114.3±7.62 vs 78.79±4.08, n = 24; p = 0.0002).

The second cohort of mice were tested for differences in activity using video tracking over an open field box and analysis with EthoVision software (Experiment 2). On day 1, evaluation of the distance travelled over a 10 minute duration using student's t test did not show statistical difference (5701±278.8 for Elfn1^−/− and 5108±222.4 for Elfn1^+/−, n = 10/genotype; p = 0.1141) (Figure 8F). However, as noted with cohort number 1, the mean activity levels of Elfn1^−/− mice were higher than for Elfn1^+/− mice. On the second day of testing, there was a significant increase in distance travelled by Elfn1^−/− mice (5360±149.4, n = 10) when compared with Elfn1^+/− mice (4710±248.6, n = 10; p = 0.0381) (Figure 8H).

Post-hoc analysis of day 1 revealed that when the distance was binned into 2 minute intervals, a significant difference is evident over the final 2 minutes when activity levels in Elfn1^+/− mice have decreased considerably (1128.24±52.69 for Elfn1^−/− and 889.42±40.36, n = 10; p = 0.0021) (Figure 8G). Likewise on day 2, post-hoc time-intervel analysis revealed a significant difference at 4–6 minutes (p = 0.0024) and again over the final 2 minutes (p = 0.0067) (Figure 8I). This replication experiment confirms a general but variable baseline hyperactivity in Elfn1 mutants, with overlap in the distribution with control mice.

Attenuation of hyperlocomotion with amphetamine

Amphetamine (AMPH) has been shown to increase extracellular dopamine levels [51]. The resultant increase in dopamine levels induces hyperactivity in normal subjects [52] and exacerbates psychotic-like hyperactivity [53], [54], [55]. Conversely, stimulant medication attenuates hyperactivity in children with attention-deficit/hyperactivity disorder (ADHD) [56], [57]. Similar effects have been observed in various animal models of ADHD [58], [59], [60], including animals with lesions in the habenula [61], [62].

We therefore examined the effects of AMPH treatments in the Elfn1 knockout mice, starting with a low dose of 0.5 mg/kg on all mice in cohort 1 [61]. The number of crosses for each mouse one week before and 15 minutes after AMPH were compared. The percentage increase or decrease in the number of line crosses per animal after 0.5 mg/kg AMPH was evaluated in a Student's t test for genotype differences and results revealed a paradoxical attenuation of hyperactivity in Elfn1^−/− mice with a mean decrease in locomotion (91.13%±10.17 n = 8) and a mean increase in locomotion, as expected, in Elfn1^+/− mice (138.3%±13.87 n = 8; p = 0.0159) (Figure 8D,E).

The effect of a higher dose of AMPH (2.0 mg/kg) was tested with the second cohort of mice, with a different experimental design. All animals received both a saline injection (control) and an injection of AMPH (1 week apart) and were tested in the open field 15 minutes after administraton. On the first day, 5 Elfn1^−/− and 5 Elfn1^+/− mice received AMPH, while the other 5 Elfn1^−/− and 5 Elfn1^+/− mice received saline. The following week, administrations of saline and AMPH were swapped. The higher dose of AMPH produced a significant decrease in average locomotion in the Elfn1^−/− mice (48.83±9.363, n = 9; p = 0.0029); however, the expected increase in activity of Elfn1^+/− mice did not occur (99.46±10.97, n = 10) (Figure 8J,K).