Figures
Abstract
Background
Cardiovascular disease is the major cause of death in renal transplant recipients (RTRs) and linked to arterial calcification. The calcium-sensing receptor (CaSR), a G-protein coupled receptor, plays a pivotal role in extracellular calcium homeostasis and is expressed in the intimal and medial layers of the arterial wall. We investigated whether common CASR gene variants are predictors for aortic and coronary artery calcification or influence risk factors such as serum calcium, phosphate and glucose concentrations in RTRs.
Methods
Two hundred and eighty four RTRs were investigated for associations between three CASR promoter region single nucleotide polymorphisms (SNPs) (rs115759455, rs7652589, rs1501899), three non-synonymous CASR coding region SNPs (A986S, R990G, Q1011E), and aortic and coronary artery calcium mass scores, cardiovascular outcomes and calcification risk factors that included serum phosphate, calcium, total cholesterol and glucose concentrations.
Results
Multivariate analysis revealed that RTRs homozygous for the minor allele (SS) of the A986S SNP, when compared to those homozygous for the major allele (AA), had raised serum glucose concentrations (8.7±5.4 vs. 5.7±2.1 mmol/L, P<0.05). In addition, RTRs who were heterozygous (CT) at the rs115759455 SNP, when compared to those homozygous for the major allele (CC), had higher serum phosphate concentrations (1.1±0.3 vs. 1.0±0.2 mmol/L, P<0.05). CASR SNPs were not significant determinants for aortic or coronary artery calcification, and were not associated with cardiovascular outcomes or mortality in this RTR cohort.
Citation: Babinsky VN, Hannan FM, Youhanna SC, Maréchal C, Jadoul M, Devuyst O, et al. (2015) Association Studies of Calcium-Sensing Receptor (CaSR) Polymorphisms with Serum Concentrations of Glucose and Phosphate, and Vascular Calcification in Renal Transplant Recipients. PLoS ONE 10(3): e0119459. https://doi.org/10.1371/journal.pone.0119459
Academic Editor: Giovanna Valenti, University of Bari Aldo Moro, ITALY
Received: August 28, 2014; Accepted: January 30, 2015; Published: March 18, 2015
Copyright: © 2015 Babinsky et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Data Availability: All relevant data are included within the paper and its Supporting Information.
Funding: This work was supported by the United Kingdom Medical Research Council (MRC) programme grant - G1000467 (to FMH and RVT); the European Commission Seventh Framework Programme (FP7-264663 (to VNB) and FP7-305608 (EURenOmics) (to OD)); the FNRS and FRSM, the NCCR Kidney.CH program (Swiss National Science Foundation), and the Gebert Rüf Stiftung (Project GRS-038/12) (to OD). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Cardiovascular disease is the major cause of premature death in renal transplant recipients (RTRs) [1]. Cardiovascular events and mortality in RTRs are strongly linked to the presence of substantial vascular calcification, which affects > 30% of transplanted patients [2]. Vascular calcification is an active disease process characterised by mineral deposition within the medial and intimal layers of the arterial wall [3, 4]. Medial calcification is a consequence of dysregulated systemic mineral homeostasis and associated with the trans-differentiation of vascular smooth muscle cells (VSMCs) in the arterial media to osteochondrocytic cells that release matrix vesicles, which act as a nidus for mineralisation in the presence of elevated circulating calcium and/or phosphate concentrations. [4]. Medial calcification reduces the compliance of large arteries such as the thoracic aorta, thereby leading to hypertension and left ventricular dysfunction [5]. Intimal calcification develops within atherosclerotic plaques, and is the major form of mineral deposition within the coronary arteries [6]. Thus, the presence of intimal calcification is an indicator of advanced atherosclerosis and associated with myocardial infarction [7]. Major risk factors for atherosclerotic plaque development and intimal calcification include elevations in serum total cholesterol and glucose concentrations, together with increased systolic blood pressure [8].
Arterial calcification has been reported to have a substantial genetic component [9, 10], and previous studies have demonstrated associations with common polymorphisms in genes encoding inhibitors of blood vessel mineralisation such as fetuin A and matrix Gla protein [11, 12]. However, the contribution to vessel calcification from polymorphisms of the calcium-sensing receptor (CaSR), which is a G-protein coupled receptor (GPCR) that plays a pivotal role in systemic mineral homeostasis through its effects on parathyroid hormone (PTH) secretion and renal tubular calcium reabsorption [13], has not been investigated. Moreover, the CaSR is expressed and functionally active in the intimal and medial layers of large elastic arteries such as the aorta, and muscular arteries such as the coronary, tibial and internal mammary arteries [14–17], and abnormal functioning of the arterially expressed CaSR has been implicated in the trans-differentiation of VSMCs to mineralising cells, and development of vessel wall calcification [17]. We therefore hypothesised that CASR variants may be determinants for arterial medial and intimal calcification, and calcification risk factors that include serum calcium, glucose and phosphate concentrations, in high risk patient groups such as RTRs, and selected six single nucleotide polymorphisms (SNPs) (3 non-synonymous coding region SNPs and 3 promoter region SNPs) (Fig. 1), five of which have been previously associated with indices of mineral metabolism and/or cardiovascular disease [18–22]. We investigated a well characterised cohort of RTRs [2, 23] for associations between these CASR SNPs and cardiovascular outcomes, mortality, coronary artery calcification (CAC) and aortic calcification (AoC), and vascular calcification risk factors, which included: systolic blood pressure, serum calcium, phosphate, total cholesterol and glucose concentrations.
The CASR gene consists of 8 exons (1a, 1b, 2–7). The start (ATG) and stop (TGA) codons are in exons 2 and 7, respectively. Exons 1a, 1b, the 5’ portion of exon 2, and the 3’ portion of exon 7 are untranslated. The 3’ portion of exon 2, exons 3, 4, 5, 6 and the 5’ portion of exon 7, encode the extracellular domain (light grey), and the mid portion of exon 7 encodes the transmembrane (dark grey) and intracellular (black) domain. Three of the six SNPs are located in the CASR promoter region. rs115759455 and rs7652589 are located 13kbp upstream from the TATA box of promoter 1 (P1) and rs1501899 is located 4.6kbp downstream of promoter 2 (P2). The remaining three SNPs (rs1801725, rs1042636 and rs1801726) encoding single amino acid substitutions (A986S, R990G and Q1011E, respectively) are clustered in exon 7. The 5’ and 3’ untranslated regions are shown as white boxes. ECD, extracellular domain; TMD, transmembrane domain; ICD, intracellular domain.
Materials and Methods
Patients
Patients were ascertained from the Brussels Renal Transplant Cohort [2, 23], which was collected between February 3rd 2004 and January 27th 2005, and comprised >280 RTRs that had an isolated kidney graft functioning for >1 year. The study protocol was approved by The Ethics Committee of the Université catholique de Louvain (UCL) Medical School, Brussels and written informed consent was obtained from all patients [2].
Clinical parameters
At baseline, clinical parameters including a history of cardiovascular events (defined as myocardial infarction, cerebrovascular event or transient ischaemic attack, and lower limb necrosis or revascularisation) were recorded by a review of the medical charts. Blood samples were obtained at inclusion for biochemical analysis. Serum creatinine, total calcium, phosphate, glucose and total cholesterol concentrations were measured using a Synchron CX analyzer (Beckman Coulter). Serum intact PTH concentrations were measured by a two-site immunoradiometric method (Nichols Institute), and serum 25-hydroxyvitamin D and 1,25-dihydroxyvitamin D concentrations were measured using a LIAISON analyzer (Diasorin Inc). At inclusion, calcification of the aorta and the main coronary arteries were assessed by multi-slice spiral CT scanning of the chest on a 16-slice scanner (Brillance 16; Philips Healthcare, http://www.healthcare.philips.com), as described [2]. The calcium mass of the thoracic aorta and the 4 branches of the main coronary arteries were scored individually, as previously described [2]. Agatston scores and amount of hydroxyapatite (mg) of the coronary arteries and thoracic aorta were measured using a manufacturer algorithm (Heart Beat CS; Philips Healthcare) and by a single operator. Intra-operator variability was 3% and 8%, respectively, for CAC and AoC [2]. Substantial amounts of coronary artery and aortic calcification were defined as >100 mg and >600 mg, respectively, as previously reported [2]. The RTRs were followed up for a mean duration of 4.4 ± 0.3 years and underwent repeat measurement of aortic and coronary artery Agatston scores by spiral CT scanning, and assessment of cardiovascular event incidence and mortality, as described [23].
Genotyping CASR gene polymorphisms
Six CASR polymorphisms were selected for analysis. Three SNPs (rs115759455, rs7652589 and rs1501899) were located in the promoter region of the CASR and three were non-synonymous SNPs located in the coding region of exon 7 (A986S (rs1801725), R990G (rs1042636) and Q1011E (rs1801726)) (Fig. 1). These six SNPs were genotyped using leukocyte DNA obtained from 284 RTRs, as described [11] and using the following PCR primers (promoter 1 forward: TGAACCTCTACAGCCCTTCG, promoter 1 reverse: GGCAATGTAAAGCGGAAAAA; promoter 2 forward: GTGGTCAGTGAGGGAGAGGA, promoter 2 reverse: GGCATGGAGTGAGGGTACAT; exon 7 forward: CAGAAGGTCATCTTTGGCAGCGGCA, exon 7 reverse: TCTTCCTCAGAGGAAAGGAGTCTGG). All SNPs were analysed by Sanger sequencing of a PCR-product amplified using the BigDye Terminator v3.1 Cycle Sequencing Kit (Life Technologies, Grand Island, NY) and an automated detection system (ABI 3730 Automated capillary sequencer; Applied Biosystems) [24]. Departure from the Hardy-Weinberg equilibrium was determined by Chi-squared analysis (X2). Observed SNP allele frequencies in the study cohort were compared to SNP frequencies of the National Heart, Lung and Blood Institute Exome Sequencing Project ((NHLBI-ESP) http://evs.gs.washington.edu/EVS/) and the 1000 Genomes Project (http://www.1000genomes.org/) [25, 26]. Haplotype frequencies were estimated by the maximum likelihood method using Haplotyper software [27]. Linkage disequilibrium was calculated using Haploview v4.2.
Statistical analysis
Analyses were performed using IBM SPSS version 20 software. Association analyses were conducted between CASR SNPs and baseline clinical and biochemical parameters. Radiological parameters measured at baseline and after a mean follow-up period of 4.4 ± 0.3 years were included in the analysis. Parameters showing a right skewed distribution were log transformed prior to parametric analyses. The power of the study was determined using the web-based program QUANTO v1.2 [28]. A univariate analysis of associations was performed using Pearson’s cross product correlation and Chi-squared test for continuous and categorical variables, respectively [11]. All variables that showed associations at the P ≤0.2 statistical level, following Bonferroni correction, were entered into a stepwise multivariate linear regression model and an assessment of confounding variables was performed. Kaplan-Meier curves were used to analyse the impact of CASR SNPs on all-cause mortality and cardiovascular event free survival and compared by the Mantel (log-rank) test [29]. Results are presented as mean ± SD, or number of patients (N (%)), as appropriate. The results of the multivariate analysis are presented as regression coefficient (B) values ± 95% confidence interval (CI). A value of P <0.05 was considered significant for all analyses.
Results
Patient characteristics
At baseline, the study cohort comprised 284 adult RTRs (168 males and 116 females) of European origin, with a mean ± SD age of 52.8 ± 12.6 years (Table 1). The patients had a moderate reduction of kidney function (CKD stage II-IIIa), explained by the post-renal transplant status, and the mean concentrations of serum biochemical markers of mineral metabolism, glucose and total cholesterol were within normal limits (Table 1). Hyperparathyroidism (defined as serum PTH concentrations >6.5 pmol/L), hyperphosphataemia (defined as serum phosphate concentrations >1.50 mmol/L) and diabetes affected 25%, 9% and 15% of the study cohort, respectively (Table 1). Baseline assessment of arterial calcification by spiral CT scanning in 266 RTRs revealed substantial amounts of CAC (>100 mg hydroxyapatite) and AoC (>600 mg hydroxyapatite) in >20% and >35% of individuals, respectively (Table 1). Follow-up CAC and AoC spiral CT assessments, after a mean period of 4.4 ± 0.3 years, in 187 individuals revealed >50% of patients to have an increase in CAC or AoC, with 30% of patients having experienced ≥1 cardiovascular events, with an overall mortality rate for the cohort of 12%.
CASR SNP frequencies in renal transplant recipients
Six CASR SNPs were selected for an assessment of genotype and allele frequencies (Fig. 1 and Table 2). Three of these SNPs are coding region variants (A986S, R990G and Q1011E), and the other three SNPs are located in the promoter region (rs7652589, rs1501899 and rs115759455). The promoter region SNP, rs115759455, has not been previously reported and was detected in this patient cohort during the study. The allelic frequencies of these six CASR SNPs (Table 2) were not significantly different to those observed in large Caucasian population cohorts such as the NHLBI-ESP and 1000 Genomes Project cohorts [25, 26]. Furthermore, the allelic frequencies of these six CASR SNPs did not deviate from the Hardy-Weinberg equilibrium (Table 2). Linkage disequilibrium was observed between the rs1501899 and rs7652589 promoter region SNPs (r2 = 0.79), but not between the other CASR variants (r2 <0.015).
Association of CASR SNPs with serum glucose, indices of mineral metabolism, arterial calcification scores and clinical outcomes
Investigations for associations between individual CASR variants and arterial calcification scores, systolic blood pressure, serum glucose, serum total cholesterol and serum markers of mineral metabolism (Table 3) revealed an association between CASR SNPs and serum metabolites, but not directly with cardiovascular disease. Thus, univariate analysis revealed a significant association between the A986S and serum glucose concentrations (Table 3). The mean glucose concentration of patients that were homozygous for the major allele A986 allele (AA; N = 216) was 5.7 ± 2.1 mmol/L compared with 8.7 ± 5.4 mmol/L for patients that were homozygous for the S986 minor allele (SS; N = 6) (P <0.05). All patients were taking prednisolone as part of their immunosuppressant regimen. However, differences in the cumulative dosage of this glucocorticoid medication did not significantly affect serum glucose concentrations in the study cohort (S1 Table).
The CASR SNPs were not significantly associated with AoC or CAC scores at baseline, or with progression of arterial calcification, or the occurrence of cardiovascular events during the study follow-up period (Table 4). Univariate subgroup analyses that excluded patients with diabetes, hyperparathyroidism or hyperphosphataemia, as these factors are key determinants of vascular calcification [30–32], also did not reveal any association between CASR SNPs and AoC or CAC scores (S2–S4 Tables). Furthermore, an analysis of CASR SNP genotypes in RTRs stratified according to the presence of low or high arterial calcification scores did not reveal any significant associations (Table 5). Using the Kaplan-Meier curve estimate, the effect of CASR variants on all-cause mortality was assessed and was shown to be absent for all the CASR SNPs (data not shown, P >0.05). An analysis of associations between multi-locus CASR haplotypes and serum glucose, indices of mineral metabolism and arterial calcification scores, was not performed due to the low prevalence of minor alleles in these haplotypes.
Following Bonferroni correction, all parameters that had associations at the P ≤0.2 statistical level were entered into a stepwise multivariate linear regression model, which corrected for potentially confounding influences (Table 6). The homozygous S986 allele continued to remain significantly associated with serum glucose after correcting for the presence of diabetes, as well as correcting for age, gender, body mass index (BMI), renal function, glucocorticoid and immunosuppressant usage, and transplantation vintage (Table 6). A significant association was also observed between the promoter region CASR SNP, rs115759455, and serum phosphate concentrations after correcting for confounding parameters such as calcium and vitamin D supplementation, serum creatinine and estimated glomerular filtration rate, serum calcium, 1.25-dihydroxyvitamin D and intact PTH concentrations. Thus, the mean serum phosphate concentration in patients homozygous for the rs115759455 major allele (CC) was 1.00 ± 0.23 mmol/L (N = 258) and 1.14 ± 0.31 mmol/L for patients harbouring the CT alleles (N = 23, P <0.05).
Discussion
Our study has revealed that the A986S CASR SNP is a predictor of serum glucose concentrations independently of BMI and the presence of diabetes mellitus. Thus, patients who were homozygous for the S986 minor allele had elevations in serum glucose, and this highlights a potential role for the CaSR as a regulator of systemic glucose homeostasis. Indeed, this would be consistent with the reported expression of the CaSR in pancreatic islet beta-cells and that CaSR activation by extracellular calcium or calcimimetic drugs in isolated islets can stimulate beta-cell activity and insulin secretion [33–35]. In addition, the CaSR is expressed and functionally active in adipocytes [36], and may potentially regulate the peripheral actions of insulin, as highlighted by the finding of an association with the A986S CASR polymorphism and insulin resistance in patients with the polycystic ovarian syndrome [37]. Moreover, altered CaSR function in diabetic patients may contribute to the development of atherosclerosis and increased cardiovascular risk [38].
A significant association was also observed with the rs115759455 5’UTR CASR SNP and increased serum phosphate concentrations. Common genetic variants have been previously linked to serum phosphate concentrations, including a SNP (rs17265703) located on chromosome 3q21.1, which was shown to be in strong linkage disequilibrium with the A986S CASR variant [39]. Our study revealed the rs115759455 minor CASR allele (T) to be an independent predictor of serum phosphate concentrations, as heterozygosity (TC), when compared to homozygosity (CC) for the major allele, was associated with significantly increased serum phosphate concentrations; such effects of homozygosity (TT) for the minor allele could not be established as only two RTRs were homozygous. Circulating phosphate concentrations are regulated by the actions of PTH and fibroblast growth factor-23 (FGF-23) on phosphate reabsorption by the proximal renal tubule, and by 1,25-dihydroxyvitamin D mediated intestinal phosphate reabsorption [40]. Our findings indicate that the CaSR may regulate phosphate homeostasis independently of its effects on circulating PTH and 1,25-dihydroxyvitamin D concentrations. Moreover, studies of mice with the combined ablation of Casr and Pth alleles indicate that such effects of the CaSR on phosphate homeostasis are also not mediated by FGF-23 [41]. Indeed, the CaSR is likely to have a direct role in regulating circulating phosphate concentrations, as highlighted by micro-perfusion studies of isolated proximal renal tubules, which have revealed CaSR activation in this nephron segment to promote renal phosphate reabsorption [42]. Our findings provide further support for the CaSR being an independent regulator of phosphate metabolism.
However, CASR SNPs were not significantly associated with the development and progression of aortic medial calcification or coronary arterial intimal calcification, or cardiovascular outcomes in RTRs. These findings contrast with a report of the A986S CASR SNP as an independent predictor of coronary artery disease and cardiovascular mortality [22]. In addition, a mouse model, Nuf, with an activating Casr mutation, has been reported to have mineralisation within the aorta, elastic and muscular arteries [43]. The differences in these studies may be partly explained by differences in the cohort characteristics e.g. patient age, ethnicity, medication history, and underlying pathologies of the different patient groups (renal transplant versus non-renal disease); as well as by species differences (man versus mouse). However, these differences may also reflect limitations in our study of the cohort of RTRs, which include the small sample size and low prevalence of some alleles. Moreover, these findings may be affected by survival bias, which favours patients with less severe cardiovascular disease and calcification. Our study of 284 RTRs had a power of 99% and 89% to detect a locus that contributed 10% or 5%, respectively, of the genetic variance, assuming a type 1 error of 0.01 and marker frequency of 0.2. This indicates that our study was sufficiently powered to detect effects that would explain up to 5% of the variance, but not 1% of variance [28]. Nevertheless, the findings of this study indicate that the six common CASR polymorphisms are unlikely to play a major role in the development or progression of aortic or coronary artery calcification in patients with renal transplants.
In conclusion, our investigation of associations between common CASR variants, arterial calcification and other cardiovascular risk factors in a cohort of renal transplant recipients indicates that these CASR variants are unlikely to represent major determinants for calcification of either the aorta or coronary arteries. However, the CaSR was demonstrated to be an independent predictor of serum glucose and phosphate concentrations, thereby highlighting potential new metabolic roles for this GPCR.
Supporting Information
S1 Dataset. Clinical, biochemical, radiological and genotype data for Brussels Renal Transplant Cohort.
https://doi.org/10.1371/journal.pone.0119459.s001
(XLS)
S1 Table. Influence of cumulative steroid dosage on serum glucose concentrations in the Brussels Renal Transplant Cohort.
https://doi.org/10.1371/journal.pone.0119459.s002
(DOCX)
S2 Table. Univariate analysis of associations between CASR SNP genotypes and aortic and coronary artery calcification in patients without hyperparathyroidism.
https://doi.org/10.1371/journal.pone.0119459.s003
(DOCX)
S3 Table. Univariate analysis of associations between CASR SNP genotypes and aortic and coronary artery calcification in patients without hyperphosphataemia.
https://doi.org/10.1371/journal.pone.0119459.s004
(DOCX)
S4 Table. Univariate analysis of associations between CASR SNP genotypes and aortic and coronary artery calcification in non-diabetic patients.
https://doi.org/10.1371/journal.pone.0119459.s005
(DOCX)
Acknowledgments
We are grateful to Miss Ruth L. Coleman at the Diabetic Trials Unit, University of Oxford for providing assistance with statistical analyses.
Author Contributions
Conceived and designed the experiments: FMH MJ OD RVT. Performed the experiments: VNB SCY CM. Analyzed the data: VNB FMH SCY CM. Contributed reagents/materials/analysis tools: MJ OD. Wrote the paper: VNB FMH MJ OD RVT.
References
- 1. Ojo AO, Hanson JA, Wolfe RA, Leichtman AB, Agodoa LY, Port FK. Long-term survival in renal transplant recipients with graft function. Kidney Int. 2000;57:307–313. pmid:10620213
- 2. Nguyen PT, Coche E, Goffin E, Beguin C, Vlassenbroek A, Devuyst O, et al. Prevalence and determinants of coronary and aortic calcifications assessed by chest CT in renal transplant recipients. Am J Nephrol. 2007;27:329–335. pmid:17505133
- 3. Amann K. Media calcification and intima calcification are distinct entities in chronic kidney disease. Clin J Am Soc Nephrol. 2008;3:1599–1605. pmid:18815240
- 4. Reynolds JL, Joannides AJ, Skepper JN, McNair R, Schurgers LJ, Proudfoot D, et al. Human vascular smooth muscle cells undergo vesicle-mediated calcification in response to changes in extracellular calcium and phosphate concentrations: a potential mechanism for accelerated vascular calcification in ESRD. J Am Soc Nephrol. 2004;15: 2857–2867. pmid:15504939
- 5. Guerin AP, London GM, Marchais SJ, Metivier F. Arterial stiffening and vascular calcifications in end-stage renal disease. Nephrol Dial Transplant. 2000;15:1014–1021. pmid:10862640
- 6. Nakamura S, Ishibashi-Ueda H, Niizuma S, Yoshihara F, Horio T, Kawano Y. Coronary calcification in patients with chronic kidney disease and coronary artery disease. Clin J Am Soc Nephrol. 2009;4:1892–1900. pmid:19833908
- 7. Wexler L, Brundage B, Crouse J, Detrano R, Fuster V, Maddahi J, et al. Coronary artery calcification: pathophysiology, epidemiology, imaging methods, and clinical implications. A statement for health professionals from the American Heart Association. Writing Group. Circulation. 1996;94:1175–1192. pmid:8790070
- 8. Kim KJ, Choi SI, Lee MS, Kim JA, Chun EJ, Jeon CH. The prevalence and characteristics of coronary atherosclerosis in asymptomatic subjects classified as low risk based on traditional risk stratification algorithm: assessment with coronary CT angiography. Heart. 2013;99:1113–1117. pmid:23723445
- 9. Rampersaud E, Bielak LF, Parsa A, Shen H, Post W, Ryan KA, et al. The association of coronary artery calcification and carotid artery intima-media thickness with distinct, traditional coronary artery disease risk factors in asymptomatic adults. Am J Epidemiol. 2008;168:1016–1023. pmid:18805900
- 10. O'Donnell CJ, Chazaro I, Wilson PW, Fox C, Hannan MT, Kiel DP, et al. Evidence for heritability of abdominal aortic calcific deposits in the Framingham Heart Study. Circulation. 2002;106:337–341. pmid:12119250
- 11. Marechal C, Schlieper G, Nguyen P, Kruger T, Coche E, Robert A, et al. Serum fetuin-A levels are associated with vascular calcifications and predict cardiovascular events in renal transplant recipients. Clin J Am Soc Nephrol. 2011;6:974–985. pmid:21527649
- 12. Yoshikawa K, Abe H, Tominaga T, Nakamura M, Kishi S, Matsuura M, et al. Polymorphism in the human matrix Gla protein gene is associated with the progression of vascular calcification in maintenance hemodialysis patients. Clin Exp Nephrol. 2013;17:882–889. pmid:23504408
- 13. Chakravarti B, Chattopadhyay N, Brown EM. Signaling through the extracellular calcium-sensing receptor (CaSR). Adv Exp Med Biol. 2012;740:103–142. pmid:22453940
- 14. Ziegelstein RC, Xiong Y, He C, Hu Q. Expression of a functional extracellular calcium-sensing receptor in human aortic endothelial cells. Biochem Biophys Res Commun. 2006;342:153–163. pmid:16472767
- 15. Smajilovic S, Hansen JL, Christoffersen TE, Lewin E, Sheikh SP, Terwilliger EF, et al. Extracellular calcium sensing in rat aortic vascular smooth muscle cells. Biochem Biophys Res Commun. 2006;348:1215–1223. pmid:16919596
- 16. Weston AH, Absi M, Ward DT, Ohanian J, Dodd RH, Dauban P, et al. Evidence in favor of a calcium-sensing receptor in arterial endothelial cells: studies with calindol and Calhex 231. Circ Res. 2005;97:391–398. pmid:16037572
- 17. Alam MU, Kirton JP, Wilkinson FL, Towers E, Sinha S, Rouhi M, et al. Calcification is associated with loss of functional calcium-sensing receptor in vascular smooth muscle cells. Cardiovasc Res. 2009;81:260–268. pmid:18852253
- 18. Scillitani A, Guarnieri V, De Geronimo S, Muscarella LA, Battista C, D'Agruma L, et al. Blood ionized calcium is associated with clustered polymorphisms in the carboxyl-terminal tail of the calcium-sensing receptor. J Clin Endocrinol Metab. 2004;89:5634–5638. pmid:15531522
- 19. Vezzoli G, Scillitani A, Corbetta S, Terranegra A, Dogliotti E, Guarnieri V, et al. Polymorphisms at the regulatory regions of the CASR gene influence stone risk in primary hyperparathyroidism. Eur J Endocrinol. 2011;164:421–427. pmid:21183554
- 20. Yano S, Sugimoto T, Kanzawa M, Tsukamoto T, Hattori T, Hattori S, et al. Association of polymorphic alleles of the calcium-sensing receptor gene with parathyroid hormone secretion in hemodialysis patients. Nephron. 2000;85:317–323. pmid:10940742
- 21. Kapur K, Johnson T, Beckmann ND, Sehmi J, Tanaka T, Kutalik Z, et al. Genome-wide meta-analysis for serum calcium identifies significantly associated SNPs near the calcium-sensing receptor (CASR) gene. PLoS Genet. 2010;6:e1001035. pmid:20661308
- 22. Marz W, Seelhorst U, Wellnitz B, Tiran B, Obermayer-Pietsch B, Renner W, et al. Alanine to serine polymorphism at position 986 of the calcium-sensing receptor associated with coronary heart disease, myocardial infarction, all-cause, and cardiovascular mortality. J Clin Endocrinol Metab. 2007;92:2363–2369. pmid:17374704
- 23. Marechal C, Coche E, Goffin E, Dragean A, Schlieper G, Nguyen P, et al. Progression of coronary artery calcification and thoracic aorta calcification in kidney transplant recipients. Am J Kidney Dis. 2012;59:258–269. pmid:21944666
- 24. Nesbit MA, Hannan FM, Howles SA, Reed AA, Cranston T, Thakker CE, et al. Mutations in AP2S1 cause familial hypocalciuric hypercalcemia type 3. Nat Genet. 2013;45:93–97. pmid:23222959
- 25. Fu W, O'Connor TD, Jun G, Kang HM, Abecasis G, Leal SM, et al. Analysis of 6,515 exomes reveals the recent origin of most human protein-coding variants. Nature. 2013;493:216–220. pmid:23201682
- 26. Genomes Project C, Abecasis GR, Auton A, Brooks LD, DePristo MA, Durbin RM, et al. An integrated map of genetic variation from 1,092 human genomes. Nature. 2012;491:56–65. pmid:23128226
- 27. Zhang Y, Niu T, Liu JS. A coalescence-guided hierarchical Bayesian method for haplotype inference. Am J Hum Genet. 2006;79:313–322. pmid:16826521
- 28.
Gauderman W, Morrison J. QUANTO 1.2. A computer program for power and sample size calculations for genetic-epidemiology studies. 2006.
- 29. Nguyen PT, Henrard S, Coche E, Goffin E, Devuyst O, Jadoul M. Coronary artery calcification: a strong predictor of cardiovascular events in renal transplant recipients. Nephrol Dial Transplant. 2010;25:3773–3778. pmid:20501456
- 30. Block GA, Hulbert-Shearon TE, Levin NW, Port FK. Association of serum phosphorus and calcium x phosphate product with mortality risk in chronic hemodialysis patients: a national study. Am J Kidney Dis. 1998;31:607–617. pmid:9531176
- 31. Kronmal RA, McClelland RL, Detrano R, Shea S, Lima JA, Cushman M, et al. Risk factors for the progression of coronary artery calcification in asymptomatic subjects: results from the Multi-Ethnic Study of Atherosclerosis (MESA). Circulation. 2007;115:2722–2730. pmid:17502571
- 32. Neves KR, Graciolli FG, dos Reis LM, Graciolli RG, Neves CL, Magalhaes AO, et al. Vascular calcification: contribution of parathyroid hormone in renal failure. Kidney Int. 2007;71:1262–70. pmid:17410101
- 33. Squires PE, Harris TE, Persaud SJ, Curtis SB, Buchan AM, Jones PM. The extracellular calcium-sensing receptor on human beta-cells negatively modulates insulin secretion. Diabetes. 2000;49:409–417. pmid:10868962
- 34. Gray E, Muller D, Squires PE, Asare-Anane H, Huang GC, Amiel S, et al. Activation of the extracellular calcium-sensing receptor initiates insulin secretion from human islets of Langerhans: involvement of protein kinases. J Endocrinol. 2006;190:703–710. pmid:17003271
- 35. Parkash J, Asotra K. L-histidine sensing by calcium sensing receptor inhibits voltage-dependent calcium channel activity and insulin secretion in beta-cells. Life Sci. 2011;88:440–446. pmid:21219913
- 36. Cifuentes M, Rojas CV. Antilipolytic effect of calcium-sensing receptor in human adipocytes. Mol Cell Biochem. 2008;319:17–21. pmid:18622738
- 37. Ranjzad F, Mahban A, Shemirani AI, Mahmoudi T, Vahedi M, Nikzamir A, et al. Influence of gene variants related to calcium homeostasis on biochemical parameters of women with polycystic ovary syndrome. J Assist Reprod Genet. 2011;28:225–232. pmid:21082232
- 38. Malecki R, Fiodorenko-Dumas Z, Jakobsche-Policht U, Malodobra M, Adamiec R. Altered monocyte calcium-sensing receptor expression in patients with type 2 diabetes mellitus and atherosclerosis. J Physiol Pharmacol. 2013;64:521–527. pmid:24101400
- 39. Kestenbaum B, Glazer NL, Kottgen A, Felix JF, Hwang SJ, Liu Y, et al. Common genetic variants associate with serum phosphorus concentration. J Am Soc Nephrol. 2010;21:1223–1232. pmid:20558539
- 40. Hu MC, Shiizaki K, Kuro-o M, Moe OW. Fibroblast growth factor 23 and Klotho: physiology and pathophysiology of an endocrine network of mineral metabolism. Annu Rev Physiol. 2013;75:503–533. pmid:23398153
- 41. Quinn SJ, Thomsen AR, Pang JL, Kantham L, Brauner-Osborne H, Pollak M, et al. Interactions between calcium and phosphorus in the regulation of the production of fibroblast growth factor 23 in vivo. Am J Physiol Endocrinol Metab. 2013;304:E310–320. pmid:23233539
- 42. Ba J, Brown D, Friedman PA. Calcium-sensing receptor regulation of PTH-inhibitable proximal tubule phosphate transport. Am J Physiol Renal Physiol. 2003;285:F1233–1243. pmid:12952858
- 43. Hough TA, Bogani D, Cheeseman MT, Favor J, Nesbit MA, Thakker RV, et al. Activating calcium-sensing receptor mutation in the mouse is associated with cataracts and ectopic calcification. Proc Natl Acad Sci U S A. 2004;101:13566–13571. pmid:15347804