A(H1N1)pdm09 virus can transmit between ferrets in the presence of specific antibodies

A model of influenza transmission under immune pressure was established by suboptimal immunization of ferrets with the human monovalent A(H1N1)pdm09 influenza vaccine with adjuvant (MIV+IFA) or vaccine alone (MIV). A single immunization of human influenza vaccine with adjuvant does not induce sterilizing immunity in ferrets ([24] and data not shown). All animals immunized once with MIV+IFA had serum antibody titres ≥40 (geometric mean titre [GMT] 332) (measured by hemagglutination inhibition, HI), while only 31% of animals immunized twice with MIV had HI titres ≥40 (GMT 10) (Table 1). In preliminary experiments, we established that the A(H1N1)pdm09 virus A/Tasmania/2004/2009 was antigenically indistinguishable from the vaccine strain A/California/7/2009 by HI assay and grew to high titres in both the upper and lower respiratory tract of naïve ferrets (data not shown). Although gene sequencing detected five amino acid differences between the HA of A/Tasmania/2004/2009 (GISAID EPI_ISL_129743) and A/California/7/2009 (GenBank: CY058519) (N38N/S, P83S, S203T, T209K, I321V, Table 2), none were in the major antigenic regions. Amino acids in HA are referenced using H1 numbering without the signal peptide [27] in this manuscript.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Table 1. Serological responses following vaccination and infection.

https://doi.org/10.1371/journal.ppat.1003354.t001

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Table 2. Full genome sequencing of inoculum and influenza virus from peak day nasal wash of all R7 ferrets.

https://doi.org/10.1371/journal.ppat.1003354.t002

We examined transmission of A/Tasmania/2004/2009 following intranasal inoculation of naïve ferrets or ferrets immunized with adjuvant and vehicle (PBS+IFA), MIV, or MIV+IFA (Figure 1 and Figure S1). In each passage line, we examined seven transmission events and confirmed effective transmission by detection of virus in nasal washes as described in Materials and Methods. Contact transmission failed twice for both MIV+IFA passage lines (Figure 1 and Figure S1). In the first instance this could be attributed to difficulty in detecting shed virus using an influenza rapid test (Figure 1 R1–R2(1); Figure S1 R0–R1(1)), so virus shedding in this group was subsequently assayed by daily real time RT-PCR. Transmission was restarted artificially by direct intranasal inoculation of a new recipient ferret with the nasal wash from the previously infected ferret. The second transmission failure (R5–R6(1)), detected using real time RT-PCR, was not due to high immunization antibody titre (data not shown) and transmission was also restarted as described.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 1. Time course of influenza transmission through passage lines.

Naïve donor 0 (D0) ferrets were directly infected with A/Tasmania/2007/2009 virus and co-housed with naïve donor 1 (D1) ferrets to begin the contact transmission model. D0 and D1 ferrets were not included in any experimental group. Once D1 was infected, D0 was removed and a ferret from one of the four experimental groups was added (R0). Transmission then proceeded through R0–R7 ferrets for each group. Line A of each group is shown. The same D0 and D1 ferrets were used to establish the passage line A of the naïve and MIV experimental groups. The same D0 ferret infected two different D1 ferrets to establish the passage line A of the PBS+IFA and MIV+IFA experimental groups. Nasal washes were collected daily from ferrets and virus load was measured by real time RT-PCR. During the experiment, both the rapid test result (PBS+IFA, MIV+IFA day 0–26) and the raw Ct value (naïve, MIV, MIV+IFA day 27 onwards) were used as a marker of infection and transmission. The data points at which transmission of virus to recipient ferrets was deemed to have occurred are identified as red symbols. Direct intranasal inoculation indicated by arrow.

https://doi.org/10.1371/journal.ppat.1003354.g001

The virus kinetics in all passage lines was assessed using real time RT-PCR to determine the relative copy number. There was no difference in the peak viral load achieved in naturally infected ferrets from any of the groups (Figure 2A). However growth rate of virus in the ferrets from the MIV+IFA passage lines was significantly lower compared to naïve and PBS+IFA-immunized ferrets (−0.83 log₁₀ copy number/100 µl/day (p = 0.049) and −1.3 log₁₀ copy number/100 µl/day (p<0.001), respectively). The growth rate of virus in the ferrets from the MIV passage line was also significantly lower compared to the PBS+IFA-immunized ferrets (−0.77 log₁₀ copy number/100 µl/day (p = 0.049)) (Figure 2B). The time between transmission events (serial interval) was longer for the MIV+IFA line (5.3 days) compared to all other lines (naïve 3.6 days (p = 0.001); PBS+IFA 3.8 days (p = 0.010); MIV 3.9 days (p = 0.011)) (Figure 2C). Within each passage line, there was no significant change in any of the kinetics measurements as passaging progressed, suggesting that the growth characteristics and transmissibility of the virus remained stable over time (data not shown).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 2. Virus replication and transmission kinetics in ferret passage lines and emergence and persistence of the N156K mutant.

(A–C) Nasal washes were collected daily from ferrets from passage lines (R0–R7) and assayed for viral RNA by real time RT-PCR as a measure of infection and transmission. (A) The peak viral load detected in the nasal wash from each ferret, (B) the viral growth rate ((peak virus load – first day virus load)/days to reach peak) and (C) the serial interval of virus transmission between ferrets (number of days between detection of infected and infecting animals) were determined for each immunization line. Ferrets artificially infected by intranasal virus inoculation are not included. Ferrets that failed to be naturally infected by contact transmission are indicated in white circles. Statistics do not include ferrets that failed to be naturally infected. (D–E) The proportion of N156 wildtype (black) and N156K (white) viruses in peak day nasal wash samples from all ferrets from the MIV+IFA (D) and N156K naïve (E) passage lines quantified by pyrosequencing. (F–G) Mixtures of (F) N156 wildtype and N156K or (G) N156K and K142N+N156K viruses were passaged by contact transmission through naïve ferrets. The proportion of N156 wildtype (black), N156K (white) or K142N+N156K (striped) in peak day nasal wash samples was quantified by pyrosequencing.

https://doi.org/10.1371/journal.ppat.1003354.g002

Emergence and persistence of a mutation in the HA1 protein in a known antigenic site following passaging of A(H1N1)pdm09 virus in immunized ferrets

RNA was extracted from nasal wash samples from the peak day of virus shedding and infection (as determined by real time RT-PCR) for genetic analysis. Once a mutation appeared in the HA or NA proteins from a ferret of any passage line, it persisted and was transmitted to all subsequent ferrets. Following inoculation of donor ferrets (D0) with egg-grown A/Tasmania/2004/2009, we detected amino acid substitutions in the HA at residues 191 (L191I) and 223 (R223Q) (Table 2). The same mutations were also detected following passage of another egg-grown A(H1N1)pdm09 virus (A/Auckland/1/2009) in ferrets (data not shown). Of interest, mutations that alter residues 191 and 223 have been associated with host specificity and receptor binding [28], [29].

Additional mutations that became fixed in the HA protein were specific to each passage line. Mutations arose in the naïve passage lines (G131S, D187E, Table 2) and in the MIV passage line (D187V, Table 2). G131S creates a potential glycosylation site and D187 has been associated with host specificity [30], [31]. The G131S, D187E and D187V viruses were antigenically indistinguishable from the wildtype virus in HI assays with serum from ferrets infected with egg-grown A/Tasmania/2004/2009 (data not shown). D14E, identified in one of the MIV+IFA passage lines, lies outside predicted antigenic sites [31], does not alter glycosylation and was not tested further.

The N156K mutation arose in both passage lines of MIV+IFA-immunized ferrets (Table 2). Position 156 of HA is in antigenic site Sb [6] (Sa in [31]) (Figure 3C, D). The relative proportions of the N156K mutant and wildtype N156 viruses were quantified in samples from both passage lines of MIV+IFA-immunized ferrets using a pyrosequencing assay. The N156K mutant emerged in R4 of line A, persisted at a similar proportion in R5, and became dominant by R6. In line B, the N156K mutant emerged earlier, in R1, and became dominant in R2, persisting through to R7 (Figure 2D). The emergence of the N156K mutation did not result in a change of virus kinetics (peak viral load, growth rate or serial interval) compared to N156 wildtype virus (data not shown).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 3. Growth, detection and adaptation of N156K virus in cell cultures.

(A) Virus underwent two passages in MDCK-SIAT1 cells (P1 and P2). Supernatant was collected during both passages, at 24, 48 and 72 h, and virus load was quantified by real time RT-PCR and hemagglutination (HAU). Infected cells were also harvested at 48 h and surface HA and M protein expression measured by flow cytometry. Cell culture adaptations detected by sequencing in the HA protein are shown in each graph. No adaptations in NA were detected. (B) Virus underwent two passages (P1 and P2) in the indicated cell lines. Virus load was quantified in supernatant as above, and cell culture adaptation was detected by sequencing the HA protein as indicated. Limit of detection is 10^3.8 copies. (C) Location of HA mutations in antigenic regions identified in this study. Visualization of mutation positions relative to classical antigenic sites [6] are shown as colored bubbles (Sa – red; Sb – green; Ca1 – cyan; Ca2 – blue; Cb – yellow). Pink balls indicate a bound host receptor ligand (α-2,6-linked); white balls indicate sugars on glycosylation sites. (D) Location of antigenic sites in HA trimer, top and side view, respectively.

https://doi.org/10.1371/journal.ppat.1003354.g003

To confirm the pyrosequencing data and to determine whether the N156K mutation was present in the original inoculum, the proportion of the N156K mutant was quantified by cloning and sequencing the HA1 gene from the original inoculum (n = 480) and from samples from the R7 ferret in each passage line, and the ferrets in which the N156K mutation was first detected (MIV+IFA R4, line A and R1, line B) (n = 96 for each) (Table S1). N156K was detected only in virus samples collected from ferrets in the MIV+IFA immunization group; proportions were similar by cloning and pyrosequencing assay (Figure 2D and Table S1). All mutations detected in the original sequencing were also detected by cloning. Cloning revealed that L191 and R223 were mixed populations (L191L/I and R223R/Q) in the original inoculum.

Two mutations were detected in the NA protein: M15I emerged in the MIV passage line A and I46F in the MIV+IFA passage line B (Table 2). Residue 15 is located in the N-terminus, while residue 46 is located in the stalk of the NA, therefore both substitutions are well outside the enzymatic site of the NA protein [32]. Full genome sequencing of R7 samples from all passage lines detected isolated changes in some genes (e.g. M, NP, PB1, PB2, PA), but none of these substitutions were in known determinants of virulence and/or transmission (Table 2).

N156K A/Tasmania/2004/2009 HA mutant virus is fit in naïve ferrets

To assess the ability of the N156K mutant virus to transmit and persist in vivo, N156K variant viruses (from MIV+IFA R7 ferrets) were passaged a further seven times by contact transmission in naïve ferrets (passage lines N156K naïve A and B). The serial interval between transmission events was similar for wildtype and N156K virus passaged in naïve ferrets (Figure 2C). Transmission proceeded without interruption (Figure S2) and both viral growth rate (Figure 2B) and peak viral loads (Figure 2A) were similar. Genetic analysis found no changes in the HA protein of virus isolated from the R7 ferret of N156K line A compared to inoculum (D14E+N156K). However, an additional mutation was detected (K142N in R4) and became fixed in the HA of passage line B (K142N+N156K, Table 2). Position 142 of HA is in antigenic site Ca2 [6], [31] (Figure 3C, D). K142N is not predicted to alter glycosylation. Full genome analysis found no other significant changes (Table 2). In both lines, pyrosequencing and sequencing of clones showed N156K persisted at approximately 100% in each sample and did not revert to wildtype N156 (Figure 2E, Tables 2, S1). The introduction of the K142N mutation did not result in a change of virus kinetics peak viral load, growth rate or serial interval) compared to N156K alone virus (data not shown).

To directly compare the fitness of the wildtype, N156K and K142N+N156K viruses in the absence of immune pressure [33], naïve ferrets were infected with mixtures of either N156 wildtype and N156K viruses (42∶58% ratio from line B R1 (Figure 2D, and Table S1, MIV+IFA B R1)) or N156K and K142N+N156K viruses (76∶24% ratio by pyrosequencing). Directly infected naïve ferrets were co-housed with naïve recipients and two transmission events occurred as before. The N156K virus outgrew the N156 wildtype virus after one or two transmission events, in duplicate experiments (Figure 2F), as in the original experiment (Figure 2D). The K142N+N156K virus outgrew the N156K virus after one or two transmission events (Figure 2G). This suggests that the N156K variant fitter than the N156 wildtype virus in the ferret model. It also suggests that the K142N mutation, when added to N156K, gives a selective advantage. However, as the K142N mutation was acquired in only one of the two lines of passaging the N156K virus seven times in naïve ferrets (Table S1), it is not essential for replication and transmission in the ferret model.

The N156K A/Tasmania/2004/2009 HA mutant virus does not agglutinate red blood cells and adapts rapidly in vitro

The HA of human influenza viruses preferentially interacts with receptors terminated with Neu5Acα-2,6-linked to galactose (reviewed in [34], [35]) and ferret lung epithelial cells predominantly express α-2,6-linked Neu5Ac residues [21]. As MDCK-SIAT1 cells have enhanced levels of α-2,6-linked Neu5Ac receptors [36], as confirmed by flow cytometry (data not shown), this cell line was used first for virus isolation. Isolates from naïve, PBS+IFA and MIV passage lines were detected in culture supernatants at high titres by agglutination of turkey RBC (HA>128). However, isolates from ferrets of the MIV+IFA and N156K naïve passage lines (herein referred to as N156K mutant virus) had only low hemagglutination titres (HA≤4). Real time RT-PCR for the matrix gene indicated that levels of viral RNA in the N156K mutant virus culture supernatant at 72 h post-infection were similar to those in control samples from naïve or PBS+IFA-immunized ferrets (herein referred to as wildtype viruses) (Figure 3A, P1). HA and matrix protein were also detected on the surface of N156K-infected cells (Figure 3A) and CPE was visible (data not shown), indicating that N156K mutant virus was present, even in the absence of RBC agglutination. Use of RBC from other species (rat, ferret, guinea pig, sheep), or resialylated RBC, or concentrated culture supernatant did not improve sensitivity in hemagglutination assays (data not shown). Upon further passage in MDCK-SIAT1 cells, the N156K mutant virus was detected only at high HA titres (HA≥16) when additional HA mutations were present (Figure 3A, P2). As folding of the mutated HA protein may be temperature dependent [37], [38], infection and culture of MDCK-SIAT1 cells with N156K mutant viruses was also attempted at different temperatures (33, 35 and 37°C), yet similar cell culture adaptations in the HA protein were observed (data not shown). Infection and culture were also attempted in the presence of exogenous neuraminidase or oseltamivir carboxylate as changes in HA have been shown to affect the HA/NA balance and influence hemagglutination and isolation in different in vitro culture systems [39]. N156K was not able to be isolated without culture adaptations in the presence of exogenous neuraminidase, or oseltamivir carboxylate (data not shown). Addition of oseltamivir carboxylate did not improve hemagglutination titres for N156K either (data not shown), indicating no binding effect of the NA [39].

Culture adaptations of the HA protein were detected at residues 153, 155 and 156, most commonly as a mixed population at position 156 (N156K/E) or with mutations at positions 153 or 155 in addition to N156K (K153E+N156K or G155E+N156K) (Figure 3A, Table 3). Culture adaptations were also seen in antigenic sites Sa and Sb (Figure 3C, D). These adaptations were not detected by clonal analysis in the nasal washes from R7 ferrets of any passage line, in the R4 or R1 ferrets of MIV+IFA passage lines A and B respectively, or in the original virus inoculum (Table S1). Culture of virus from peak day samples containing mixed populations of wildtype (N156) and N156K viruses resulted in outgrowth of the wildtype N156 virus as determined by RNA extraction and sequencing (data not shown). No MDCK-SIAT1 culture adaptations were detected in the NA gene.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Table 3. Mutations and cell culture adaptations in A(H1N1)pdm09 HA protein.

https://doi.org/10.1371/journal.ppat.1003354.t003

Attempts to isolate the N156K mutant virus in a variety of other cell lines (MDCK, Beas-2B, Vero, A549) as well as embryonated hen's eggs, were unsuccessful. The virus either did not grow, or it grew and was detected by real time RT-PCR, but rapidly adapted in the HA at amino acids 153–156 (Figure 3B).

Attempts were also made to purify virus by ultracentrifugation from ferret bronchoalveolar lavage and homogenized lung samples, but this did not yield sufficient virus for analysis.

Detection of N156K and culture adaptations in influenza surveillance data

The N156K mutation has been detected in human A(H1N1)pdm09 clinical samples (analyzed for surveillance purposes at the WHO Collaborating Centre for Reference and Research on Influenza, Melbourne), both alone and in conjunction with N125D, which is located in antigenic site Sa [6], [40] ) (Table 3 and Figure 3C, D). N156D has been detected following passage of A(H1N1)pdm09 virus in embryonated hen's eggs under immune pressure [16]. Mutations at G155 and K153 have been reported following in vitro passage of A(H1N1)pdm09 viruses in the absence [29] and presence of monoclonal antibodies (mAbs) [15], [16]. Cell culture adaptations have also been detected in routine surveillance at the WHO Collaborating Centre for Influenza, Melbourne, when passaging A(H1N1)pdm09 viruses with mutations at N156 (Table 3). Analysis of all A(H1N1)pdm09 sequences from 2009–2012 in GISAID and GenBank found N156K, K153E and N156D at similar low frequencies (0.15, 0.20 and 0.27%, respectively); G155E has been reported more often (1.30%, Table 4). Among 8446 A(H1N1)pdm09 HA sequences with classifiable passage information, most were MDCK cell isolates (69%) followed by original clinical samples (18%), MDCK-SIAT1 isolates (8%) and embryonated hen's egg isolates (5%). There is no change in isolation patterns in each year (2009–2012, data not shown). The N156K mutation was found more commonly in original specimens than in cell isolates. In contrast, K153E and G155E adaptations were strongly associated with growth in MDCK cells (Table 4).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Table 4. Analysis of passage history of surveillance viruses with mutations in key residues of HA1 as reported on GISAID and GenBank.

https://doi.org/10.1371/journal.ppat.1003354.t004

Cell culture adaptations may disguise the effect of N156K on the antigenic profile of A/Tasmania/2004/2009 virus

Other in vitro studies have demonstrated that mutations at amino acids 153, 155 and 156 of A(H1N1)pdm09 HA1 result in antigenic drift with a reduction in HI titre to the mAbs used to induce changes in the antigenic sites [15], [16] and to serum from wildtype A(H1N1)pdm09-infected ferrets [29]. Adaptations K153E and G155E are also antigenically distinct from each other [16]. We generated viruses containing the HA mutation(s) detected in our experiments by reverse genetics. All reverse genetics viruses used contained the ferret-specific adaptations L191I and R223Q in the HA protein. Neither the N156K alone nor K142N+N156K virus could be rescued as a pure population without adaptation. Rescues were attempted with both an A(H1N1) (A/PuertoRico/8/1934) and an A(H1N1)pdm09 (A/Perth/261/2009) complete backbone and were also attempted with ‘humanized’ vectors containing receptors L191 and Q223, but neither was successful (data not shown). Antigenic analysis by HI assay showed a reduction in HI titre for all reverse genetics viruses with mutations at positions 153–156, against serum from a ferret infected with the original inoculum of A/Tasmania/2004/2009 virus, compared to wildtype virus. Both reverse genetics mutant N156E as well as surveillance viruses with mutations and adaptations at N156 showed reduced HI titre compared to wildtype virus, indicating the antigenic importance of amino acid 156. The K142N mutation had no effect (Table 5).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Table 5. Antigenic analysis of mutations in the HA protein from amino acid 153–156.

https://doi.org/10.1371/journal.ppat.1003354.t005

All reverse genetics viruses were also tested against serum from a ferret immunized once with MIV+IFA. All viruses containing mutations at positions 153–156 showed a four-fold reduction in titre compared to wildtype virus. Although the K142N mutation on its own had no effect, addition of this mutation to viruses with mutation/s at positions 153–156 reduced their titre at least four-fold further (Table 5).

The HA antigenicity and receptor binding profile are altered in the N156K A/Tasmania/2004/2009 HA mutant virus

Our observation that N156K mutant viruses were not detected by hemagglutination and did not persist without adaptation in vitro suggested an alteration in receptor binding specificity. N156K and K142N (and K153E, R223Q) are located in regions on the HA protein proposed to contact sugars beyond Neu5Ac on cell surface receptors [28]. Thus we hypothesized that these mutations altered not only antigenicity but also receptor binding compared to wildtype virus.

HA structure was investigated by flow cytometry [41] using mAb174 and mAb175, which are specific for the Sa/Sb (K153 and G155) and Cb (T72) antigenic regions of the A(H1N1)pdm09 virus HA, respectively. All A(H1N1)pdm09 wildtype and variant viruses were recognized by mAb175 (Figure 4A). The A/Tasmania/2004/2009 original inoculum and ferret-adapted wildtype viruses were recognized by mAb174, but binding was greatly reduced in the presence of the N156K mutation and cell culture adaptations (Figure 4A). This effect was specific for viruses with mutations in the Sa/Sb antigenic region as the virus with K142N mutation alone was still recognized by mAb174.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 4. Analysis of antigenicity and glycan binding to HA on influenza virus-infected cells.

MDCK-SIAT1 cells were inoculated with A/Tasmania/2004/2009 egg-grown inoculum, ferret nasal wash (indicated by ∧) or rescued reverse genetics ferret-adapted viruses (indicated by ‘rg’) or a control A(H3N2) egg-grown virus. After 48 h, cells were analysed for binding of (A) anti-HA mAbs, (B) post-immunization ferret antisera (MIV or MIV+IFA) or post-infection ferret antisera (wildtype A/Tasmania/2004/2009, N156K or K142N+N156K virus) or (C) synthetic glycans. (B) To control for differences in infection rate between wildtype and N156K viruses, antibody binding is expressed as the proportion relative to K142N+N156K antiserum (% positive for test antiserum/% positive K142N+N156K antiserum). Mean+standard deviation of six paired experiments are shown for all antisera except MIV+IFA which is calculated from three paired experiments. (C) Glycan binding is expressed as a proportion to itself ((mean fluorescent intensity (MFI) with glycan-MFI without glycan)/MFI with glycan×100), for influenza A matrix positive cells only. Individual experiments are shown by each symbol.

https://doi.org/10.1371/journal.ppat.1003354.g004

Direct binding assays using antisera from immunized and virus-infected ferrets were used to assess the antigenicity of the N156K mutant virus. Antisera from MIV−, MIV+IFA-immunized ferrets or from ferrets infected with wildtype virus recognized cells infected with N156K virus less efficiently than cells infected with wildtype virus. In contrast, post-infection antisera from ferrets infected with N156K or K142N+N156K viruses bound cells infected with wildtype or N156K mutant virus to a similar degree (Figure 4B). These data suggest that the N156K virus is antigenically distinct from wildtype virus. Furthermore, it is likely that the wildtype antiserum contains a high level of antibodies directed towards the N156 region of the HA protein, whilst the N156K and K142N+N156K antisera contains antibodies that are directed towards a region of the HA protein, common to both wildtype and N156K HA.

HA receptor specificity was assessed by binding of synthetic multivalent glycans. Human influenza viruses have been shown to bind predominantly to 6′ sialyllactose (6′SL) and 6′ sialyllactosamine (6′SLN) and, to a lesser extent, to 3′ sialyllactose (3′SL), as representatives of α-2,6- and α-2,3-linked Neu5Ac receptors [28], [41]–[45]. HA on the surface of cells infected with ferret adapted A/Tasmania/2004/2009 wildtype virus bound to both 6′SL and 6′SLN (Figure 4C). Binding was more restricted compared to the original egg inoculum virus, presumably due to the mutations L191I and R223Q (Figure 4C). Introduction of the N156K mutation to the ferret adapted virus resulted in binding to only 6′SLN, indicating a strong preference for α-2,6-linked Neu5Ac receptors containing GlcNAc rather than galactose (Figure 4C, N156K, D14E+N156K, K142N+N156K). K142N and N156E displayed a similar profile to N156K. K153E showed weak binding to 6′SLN, G155E showed binding to 6′SL and 6′SLN. Addition of G155E to N156K increased 6′SL binding, while the addition of K153E to N156K did not alter the binding preference.

Predicted receptor binding properties and structural analysis using 3-D modeling

Computer modeling with α-2,6- and α-2,3-linked Neu5Ac receptors was performed to enable a structural basis for the N156K mutation and subsequent cell culture adaptations. The computational results were also compared to the glycan binding results (Figure S3A). N156K is at the interface of three previously crystallized antibody binding sites [46]–[48] (Figure S3B). Since amino acid mutations that involve charge changes can alter the strength of the electromagnetic field around the HA globular head, and long range electrostatic forces are often a first step to facilitate interaction with ligands and other proteins, changes in the electrostatic surface potential due to the observed mutations were also analyzed.

Although position 156 is not in the receptor binding site, our analysis suggests that small changes at this position influence HA binding, stability and receptor specificity. The N156K mutation noticeably adds positive charge potential compared to wildtype HA (Figure 5A, B). In contrast, N156E significantly reconfigures the distribution of charge (Figure 5C). N156K is predicted to prefer α-2,6-linked receptors (Figure 5E), whilst in our models it is more favorable for the N156E mutation to bind to α-2,3-linked receptors (Figure 5E). Adding K153E to N156K reduces the positive electrostatic potential of the HA head domain (Figure 5D) as does the addition of G155E to N156K (Figure S3C). The addition of K153E to N156K (and G155E to N156K) appears compensatory, allowing stronger binding to α-2,3 receptors compared to N156K alone (Figure 5F, Figure S3C,D). However, this increased α-2,3 receptor binding was not evident in the glycan binding studies that were undertaken (Figure 4C).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 5. 3-D modeling of HA containing N156K and cell culture adaptations.

(A–D) Comparison of electrostatic surface potential of wildtype and single and pair mutations in the HA head domain, calculated with the Particle Mesh Ewald method implemented in YASARA. Blue indicates positive and red indicates negative charge potential. A host receptor analogue is shown in magenta. (E,F) Structural modeling of single and pair mutations in HA with bound α-2,6- or α-2,3-linked host receptor ligands. (E) Model of N156 wildtype (green HA/yellow ligand), N156K (cyan HA/red ligand) and N156E (blue HA/purple ligand) shown with α-2,3 host receptor analogue. (F) Comparison of N156 wildtype (green HA/yellow ligand) and N156K (cyan HA/red ligand) with double mutant K153E+N156K (light blue HA/orange ligand).

https://doi.org/10.1371/journal.ppat.1003354.g005

Ferrets

Male and female ferrets (weight, 500–1500 g) were purchased from independent breeders and housed at CSL Limited using services provided under a Support Services Agreement. Serum samples from ferrets were tested by HI assay to ensure seronegativity (titre <20) to currently circulating influenza strains before use. Experiments using ferrets were conducted with approval from the CSL Limited/Pfizer Animal Ethics Committee, in accordance with the Australian Code of Practice for the Care and Use of Animals for Scientific Purposes.

Viruses and cells

A/Tasmania/2004/2009 virus was isolated from an elderly patient who succumbed to influenza infection in July 2009, as part of routine influenza surveillance activities at the WHO Collaborating Centre for Reference and Research on Influenza, Melbourne. The sample was anonymized. Viruses were passaged in the allantoic cavity of embryonated hen's eggs and MDCK-SIAT1 cells and stored at −80°C. MDCK (CCL-34:ATCC) and MDCK-SIAT1 cells (kindly provided by Hans-Dieter Klenk, University of Marburg, Marburg, Germany) were maintained as previously described [52], in the absence of G418 sulphate. A549 and Vero cells were maintained in the same conditions as MDCK cells. BEAS-2B cells (kindly provided by Dr R. Gualano The University of Melbourne, Melbourne, Australia) were maintained in 1∶1 (v/v) RPMI −1640 (SAFC Biosciences) supplemented with 10% [v/v] FCS, 50 U/ml penicillin, 50 µg/ml streptomycin (SAFC Biosciences): BEGM with BulletKit (Cambrex, Clonetics, USA). Cells were maintained at 37°C, 5% CO₂ prior to infection and following infection, unless indicated.

Vaccine formulation and administration

Full or half adult doses (15 µg or 7.5 µg HA in 0.5 mL, respectively) of human monovalent A(H1N1)pdm09 influenza vaccine containing the HA and NA of A/California/7/2009 (MIV) (Panvax, a gift from CSL Limited) were used for immunization. Ferrets were immunized with MIV alone or MIV emulsified in an equal volume [1∶1 (v/v)] Freund's Incomplete Adjuvant (IFA) (Sigma-Aldrich) immediately before administration (1 ml total volume) (MIV+IFA). Control ferrets were immunized with PBS emulsified in IFA (1 ml total volume) (PBS+IFA) or did not receive vaccine (naïve). Adjuvanted vaccines were delivered to anaesthetized animals (0.2 mL/kg, 1∶1 [v/v] Ilium Xylazil-20∶Ketamil, Troy Laboratories) intramuscularly in the quadriceps muscles of both hind legs using a 1-mL syringe with a 22-gauge needle. Animals received one dose of MIV+IFA or PBS+IFA or two doses of MIV two weeks apart. Vaccinated animals were used 24 to 94 days after the final immunization. Serum was collected before and after each vaccination, immediately before ferrets were included in the contact transmission passaging and at sacrifice.

Virus infection of donor ferrets and passaging of virus by contact transmission

Naïve donor ferrets (termed Donor 0; D0) were anaesthetized and infected artificially by intranasal inoculation with 10^3.5 50% tissue culture infectious doses (TCID₅₀) egg-grown influenza virus. After inoculation, D0 ferrets were housed individually in a HEPA-filtered isolation unit. The following day, two naïve ferrets (both termed Donor 1; D1) were co-housed with each D0 ferret and remained in continual contact, until they became naturally infected with influenza virus (see below). Once a D1 ferret was found to be infected it was placed in a separate clean cage, to then infect the first ferret of a passage line. Naïve donor ferrets (D0 and D1) were used to establish a transmission chain as previous studies have indicated that direct inoculation of in vitro cultured virus can alter viral diversity within a host [53]. Four different D0 ferrets infected seven different D1 ferrets, each D1 ferret was assigned to start one (or two) passage lines (as indicated in Figure 1 and S1). Each line involved sequential passage of virus through eight recipient ferrets that had received one of three different treatments (MIV+IFA, MIV, PBS+IFA) or no treatment (naïve). The first recipient ferrets from each immunization group (R0) were co-housed with one of the D1 ferrets until they became naturally infected. 24 hours after the viral load measurement from each R0 ferret indicated that they were infected, the R0 ferret was co-housed with the next recipient ferret (R1) from their line. Transmission experiments continued for each immunization group until seven passages had been completed (R0 to R7). Duplicate lines were performed for each immunization group, designated line A and line B. Ferrets were sacrificed and respiratory tissues and serum were collected after they had successfully transmitted the virus to the new recipient ferret. The recipient order for the passage lines was randomly assigned in each immunization group, irrespective of HI antibody titre following immunization, or days since immunization.

Detection of virus infection in ferrets

Nasal washes were collected daily under light sedation (30 mg/kg Ilium Xylazil-20; Troy Laboratories) by delivery of 1 ml PBS supplemented with 50 U/ml penicillin, 50 µg/ml streptomycin (SAFC Biosciences) and 1% w/v BSA (Sigma-Aldrich) into the nostril. Expelled liquid was collected and 140 µl was aliquoted for RNA extraction (see below) and real time RT-PCR analysis, 60 µl for TCID₅₀ analysis, 30 µl for rapid test analysis and the remainder stored at ⁻80°C. Animals were weighed and visually inspected daily and their temperature was measured using implanted temperature transponders fitted to identification chips (LifeChip Bio-Thermo, Digivet). Daily nasal wash samples were assessed for virus shedding as a measure of infection by rapid test analysis (BD Directigen EZ Flu A+B kit, Becton Dickinson) or by real time RT-PCR analysis of extracted RNA for matrix 1 gene. Transmission was deemed to have occurred when the new recipient ferret returned a positive rapid test, or a positive real time RT-PCR result (Ct≤25).

Real time RT-PCR

RNA was extracted from nasal washes, cell culture supernatants or allantoic fluid using the QIAamp Viral RNA Mini Kit (Qiagen). An 8 µl aliquot of RNA was treated with RNAse Free DNase I (New England Biolab) in a total reaction volume of 10 µl, according to the manufacturer's instructions. DNase-treated RNA (4 µl ) was used to amplify influenza A matrix 1 using CDC Atlanta (USA) InfA F primer and InfA probe [54] and modified InfA R primer (5′GGGCATTYTGGACAAAKCGTCTACG3′) with SuperScript III Platinum One-Step qRT-PCR kit (Invitrogen). The RT-PCR consisted of 1 cycle of 50°C for 5 min and 95°C for 2 min and 40 cycles of 95°C for 3 s, 60°C for 30 s using the 7500 Fast Real-Time System (Applied Biosystems) and 7500 Fast System SDS Software version 1.4.0. The threshold was automatically set and Ct determined. RNA standards were prepared from pGEMT-A/California/7/2009 and pGEMT-A/Perth/16/2009 Matrix plasmids using the Riboprobe In Vitro Transcription Systems (Promega). For all runs, samples (assayed in duplicate), no-template control, RNA standards and positive and negative controls were included. The 95% confidence interval for RNA standards was 0.78 Ct (n = 65 assays). The detection limit was 10 copies.

Preparation of cDNA for genetic analysis

cDNA was synthesized from 5 µl RNA isolated from ferret nasal wash (peak day of infection), cell culture supernatants or allantoic fluid, using the SuperScript III First-Strand Synthesis SuperMix (Invitrogen), with Uni12 primer [55], according to the manufacturer's instructions. cDNA generated from ferret nasal wash was sequenced, used in pyrosequencing assays, or amplified by PCR and cloned.

Genetic sequencing

Viral genes were amplified from cDNA or DNA plasmids (see below) using MyTaq HS Mix (Bioline) with M13 tagged-gene-specific primers ([56] and WHO Collaborating Centre for Reference and Research on Influenza, Melbourne – sequences available upon request) or plasmid-specific primers, according to the manufacturer's instructions. Unincorporated primers and dNTPs were removed using ExoSAP-IT (Affymetrix), according to the manufacturer's instructions. DNA sequencing was performed with M13 primers (M13F-5′ TGTAAAACGACGGCCAGT and M13R 5′ CAGGAAACAGCTATGACC) or plasmid-specific primers in a 96-well plate format using the BigDye Terminator v3.1 Cycle Sequencing Kit (Life Technologies), followed by the removal of excess dye terminators with a BigDye XTerminator purification kit (Applied Biosystems). The sequence was determined using an automated capillary DNA sequencer (ABI Prism 3500xL). Identification of mixed bases was set at 25%. Sequences were assembled using DNASTAR Lasergene Suite v.9.1.0 Seqman v 9.1.

Nucleotide sequence accession numbers

The nucleotide sequences for all segments of A/Tasmania/2004/2009 egg-grown virus inoculum are available from the GISAID public database under accession number EPI_ISL_129743. A/California/7/2009 sequences used in this study were from GenBank: CY058519, GQ214336, CY121681, GQ338390, CY121684, CY121685, GQ323558, FJ984387.

Generation of DNA plasmids

The HA1 gene of A/Tasmania/2004/2009 virus from cDNA generated from ferret nasal wash was amplified using gene-specific primers and cloned into pGEM-T Easy vector (Promega) according to the manufacturer's instructions. For reverse genetics, the entire HA and NA genes of A/Auckland/1/2009 (A(H1N1)pdm09) virus [24] were amplified from cDNA generated from a clinical specimen using ThermoScript RT-PCR System (Invitrogen) using primers containing BsmBI and BsaI sites respectively, and cloned into pHW-2000 vector [57] according to the manufacturer's instructions. S203T, Q223R and H496N were introduced into the HA gene to generate pHW-2000-A/Tasmania/2004/2009 HA vector. L191I and R223Q were then introduced to generate ferret-adapted pHW-2000-A/Tasmania/2004/2009 HA vector. S388T was introduced into the NA gene to generate pHW-2000-A/Tasmania/2004/2009 NA vector. Further mutations and adaptations were introduced as indicated in the text. Mutations were introduced using the QuikChange II Site-Directed Mutagenesis kit (Strategene) with the QuikChange Primer Design Program.

Pyrosequencing assay to quantify the proportion of the wildtype, N156K or K142N+N156K mutants

Two separate pyrosequencing assays were utilized. The first quantified the proportion of the N156 (wildtype) vs the N156K mutant (WT/N156K). The second assay quantified the proportion of K142 vs K142N mutant (N156K/K142N+N156K). A 350 bp region of the HA1 gene flanking amino acid positions 142 and 156 was amplified from plasmid mixtures and from cDNA from ferret peak day nasal wash samples using MyTaq HS Mix (Bioline) with biotinylated forward primer (5′Biotin-GCAATTGAGCTCAGTGTCATC) and reverse primer (5′TTCCGGCTTGAACTTCTTGC) (for the WT/N156K assay) or forward primer (5′GCAATTGAGCTCAGTGTCATC) and biotinylated reverse primer (5′Biotin-TTCCGGCTTGAACTTCTTGC) (for the N156K/K142N+N156K assay), according to the manufacturer's instructions. The pyrosequencing reaction was performed as previously described [58], using internal primers 5′GGATTTGCTGAGCTTTGGGT and 5′CTCATGCTGGAGCAAA, specific for the N156K and K142N mutations, respectively. The proportions of N156 and K156, or K142 and N142, HA in the sample, were estimated by calculating the ratio of the two peaks representing the N156 and K156, or K142 and N142 HA, using the AQ mode in the PyroMark ID 1.0 software. The N156K mutation generates a quadruplicate run of adenosines, which does not quantify absolutely by this technology [59]–[61], thus the detection limit was 5–10% for N156K. To correct for the sensitivity of the assay, all nasal wash samples were run with a set of plasmid mixtures containing various ratios. Mixtures of pGEMT plasmids with A/Tasmania/2004/2009-HA1 and A/Tasmania/2004/2009-HA1-N156K or A/Tasmania/2004/2009-HA1-N156K and A/Tasmania/2004/2009-HA1-K142N+ N156K inserts were prepared at different molar ratios (100∶0, 80∶20, 50∶50, 20∶80, 0∶100), at multiple concentrations (1, 0.1, 0.001 pg total). A standard curve was generated using the plasmid mixtures and the proportion of N156/K156 or K142/N142 in each nasal wash sample was determined by comparison to a standard curve. All samples were run in triplicate.

Analysis of variants by cloning

The HA1 gene was amplified from cDNA generated from ferret nasal washes or egg-grown A/Tasmania/2004/2009 using the Velocity PCR kit (Bioline) with M13 tagged-HA1-specific primers (as above). Amplified product of the correct size was purified using the E-Gel CloneWell system (Invitrogen) and cloned using the Zero Blunt TOPO Cloning Kit for Sequencing (Invitrogen). DNA from 96 individual colonies with confirmed HA insert was sequenced for all samples except the initial inoculum for which 480 colonies were sequenced. HA1 was amplified using MyTaq HS Mix (Bioline) and A/Tasmania/2004/2009 HA1-specific primers ((F 5′ TAGTTCTGCTATATACATTTGCAACCG, R-5′GGATGTATATTCTGAAATGGGAGGC) then sequenced using the same primers. Poor quality sequences were excluded from the data set. As a control, the pGEMT-A/Tasmania/2004/2009 HA1 plasmid was transcribed using the Riboprobe In Vitro Transcription Systems (Promega), cDNA synthesized as above, then the HA1 gene amplified and cloned; 96 individual colonies were sequenced. The error rate in the amplification system, as determined by sequencing 96 clones from a single plasmid, was less than 0.001%.

Reverse genetics rescue of influenza A viruses

Engineered viruses were generated as previously described [57], with infectious virus detected by hemagglutination and real time RT-PCR of culture supernatants. All viruses contained the HA and NA from ferret-adapted A/Tasmania/2004/2009 including specified mutations, whilst the remaining genes were from A(H1N1) A/Puerto Rico/8/1934 (pHW2000-A/Puerto Rico/8/1934 vectors, a kind gift from St Jude Children's Research Hospital, Memphis, TN, USA) or A(H1N1)pdm09 A/Perth/261/2009.

Virus infection of cell cultures and analyses

Cells were seeded into T25 flasks or 24-well tissue culture plates and grown to confluence overnight. Monolayers were washed twice with Ca²⁺/Mg²⁺-free phosphate-buffered saline before incubation with 500 or 100 µl virus, respectively (nasal wash samples inoculated at 1/6 to 1/10 dilution; cell culture isolates inoculated neat; egg-grown virus inoculated at 1/100) at 37°C and 5% CO₂ for 30 min, or other temperatures, as indicated. The inoculum was removed and replaced with medium (without fetal calf serum) supplemented with 4 µg/ml trypsin (Sigma) [52]. 2 mU/ml exogenous neuraminidase (from Clostridium perfringens (Sigma) or 5 nM oseltamivir carboxylate (the active form of the ethyl ester prodrug oseltamivir phosphate, kindly provided by Hoffmann-La Roche Ltd, Switzerland) was added to cultures as indicated in the text. Supernatant was collected daily and the presence of virus was assessed by hemagglutination using 1% turkey RBC and by real time RT-PCR assays for the influenza A matrix gene. Infection was also assessed by surface staining of infected cells and analysis by flow cytometry. Cells were stained with anti-influenza A HA monoclonal antibodies (mAbs) (A(H1N1)pdm09: mAb174 clone 10F5.1D7 and mAb175 clone 2G10.1C11; A(H3N2): mAb131 clone 4E4.1F10 and mAb 132 clone 1G6.1G7; kindly provided by CSL Limited), ferret antisera, followed by anti-ferret Ig-FITC (Rockland Immunochemicals Inc., USA) or anti-influenza A matrix mAb (clone GA2B, AbD Serotec, UK), followed by anti-mouse Ig-FITC (SantaCruz Biotechnology and KPL). Staining was performed in the presence of 1 µM oseltamivir carboxylate. Samples were run on a FC500 Analyzer (Beckman Coulter) or FACSCanto II (BD Biosciences) with data analysis using FlowJo 7.5.5 software.

Flow cytometry-based glycan binding assay

The binding specificity of influenza HA was determined using an assay previously described [41]. Briefly, MDCK-SIAT1 cell monolayers, in 24-well plates, were infected with the same copy number of influenza virus from different ferret nasal washes, or reverse genetics viruses. After 48 h, cells were harvested, washed three times with PBS and stained with biotinylated multivalent glycans (5 µg/ml) and mouse anti-influenza A matrix mAb in PBS, with 1 µM oseltamivir carboxylate for 2 h at 4°C. Glycans, Neu5Acα2-6Galβ1,4GlcNAc-PAA-biotin (6′ sialyllactosamine; 6′SLN), Neu5Acα2-3Galβ 1,4Glc-PAA-biotin (3′ sialyllactose; 3′SL) and Neu5Acα2-6Galβ 1,4Glc-PAA-biotin (6′ sialyllactose; 6′SL), were purchased from GlycoTech (MD, USA). To detect biotinylated glycan binding, cells were incubated with streptavidin-RPE (Vector Laboratories, USA) and mouse mAb was detected with anti-mouse Ig-FITC in PBS with 1 µM oseltamivir carboxylate, for 1 h at 4°C. Samples were analysed by flow cytometry. Cell culture supernatant was also collected upon cell harvest and assessed by real time RT-PCR and hemagglutination. HA and NA genes were sequenced to ensure no adaptations had occurred.

Hemagglutination Inhibition (HI) assay

Reactivity of serum samples was measured using HI assays [62] as described elsewhere [63]. Titres were expressed as the reciprocal of the highest dilution of serum for which hemagglutination was prevented. GMT was calculated with undetectable titres expressed as ‘5’. Seroconversion was defined as titre ≥40.

Statistics

Viral growth kinetics were assessed using real time RT-PCR data. Animals artificially infected by intranasal inoculation were excluded from the analysis. The virus growth rate was calculated as the difference between viral copy number between the peak day and the first day, divided by the number of days to reach peak viral copy number. Animals for which viral load peaked on day 1 were excluded. The serial interval between transmission was defined as the number of days between virus detection in the infecting and infected ferret. Only transmission events where both animals were deemed infected using the same method of detection were included. Transmission events involving artificially inoculated animals or interruptions (see results) were excluded. Data were analysed using one-way ANOVA, and Bonferonni correction to adjust for multiple comparisons, using STATA. Ferret antisera binding to virus-infected cells was analyzed by comparing the relative proportion from wildtype and N156K-infected cells for each antiserum using Spearman's rank correlation co-efficient. Statistically significant results are indicated with * p<0.05, ** p<0.01 and *** p<0.005.

Analysis of frequency of mutations in human clinical specimens on GISAID and Genbank

All A(H1N1)pdm09 HA sequences from viruses isolated from a human host since 2009 were downloaded from GISAID and GenBank, and filtered to remove strains occurring multiple times. The resulting 16740 sequences were aligned using MAFFT [64]. To determine whether a mutation preferentially occurred in a culture type, sequences with passage history were classified into four categories based on the source from which they were extracted and sequenced: (i) embryonated hen's egg, (ii) MDCK cells, (iii) MDCK-SIAT1 cells and (iv) original clinical sample. The odds ratios were calculated from the probabilities of occurrence of the mutant and the wildtype in each of the source cell types. The degree of association of the mutants to the source cell types were classified into 5 categories: (i) moderate association (1.5–3), (ii) strong association (>3.0), (iii) moderate negative association (0.33–0.66), (iv) strong negative association (<0.33) and (v) no association (0.66–1.5) [65].

3-D modeling

Simulated annealing energy minimizations through short molecular dynamics (MD) simulations using the AMBER03 force field in YASARA were done for wildtype and mutant HAs in complex with either α-2,3 or α-2,6 ligand (PDBs: 3ubj chains C and D or 3ube chains A and B, respectively [66]. For structural correspondence, only the sialic acid and the first bound galactose of the ligands were kept. The ligands were parameterized automatically by YASARA [67]. YASARA has been previously shown to provide excellent results in the CASP competition for homology model refinements [68]. The used minimization protocol comprises the following steps: in short, to remove bumps and correct the covalent geometry, the structure was energy-minimized with the AMBER03 force field [69], using a 7.86431 Angstroem force cutoff and the Particle Mesh Ewald algorithm [70] to treat long-range electrostatic interactions. After removal of conformational stress by a short steepest descent minimization, the procedure continued by simulated annealing (time step 2 fs, atom velocities scaled down by 0.9 every 10th step) until convergence was reached, i.e. the energy improved by less than 0.05 kJ/mol per atom during 200 steps. Counterions are implicitly considered by setting the net charges to 0. Solvation is also considered implicitly by a term proportional to the accessible surface area. 1.2 kJ/mol was used as the estimate for the entropic cost of exposing one square Angstroem to the solvent. To further reduce the computational complexity and potential unrelated simulation bias, atoms further than 8 Angstroem from either the ligand or the respective mutated residues were fixed (not allowed to move). This resulted in a system of both flexible ligand and flexible receptor binding pocket. The relative binding energies were estimated through a function considering standard potential energy terms plus the above mentioned implicit solvation. Three steps of sequential forward and backward mutations for each mutation set were employed and averaged over the visited energy minima. Finally, for each analyzed single or pair mutation(s) we subtracted the predicted energy for binding the α-2,6 receptor from the predicted energy for binding the α-2,3 receptor. Higher values of the measure therefore indicate α-2,6 preference while lower values would point to relative α-2,3 preference. In order to compare the predicted measure with the experimental glycan binding data (see above), we derived a corresponding relative preference value by subtracting the mean fluorescence intensity of glycan expression for 3′SL from the average for 6′SL and 6′SLN for the respective mutation(s). The subtraction order of experimental receptor data was inversed to obtain a direct linear correlation with the computational measure.