Patient specimens
CRC tissues and corresponding paired normal tissues were obtained from CRC patients who underwent surgical resection at the Tangdu Hospital affiliated with Air Force Medical University (Xi’an, China). The tissues were frozen and stored in liquid nitrogen after resection. All procedures were approved by the Research Ethics Committee of Tangdu Hospital, and a written informed consent was obtained from all the patients.
Regents and antibodies
Erastin (S7242), Ferrostatin-1 (S7243), necrosulfonamide (S8251), Z-VAD-FMK (S7023), and chloroquine diphosphate (S4157) were purchased from Selleck (Houston, TX, USA). The CCK-8 assay kit (C008-4) was purchased from 7 Sea (Shanghai, China). FITC Annexin V Apoptosis Detection Kit I (556547) was purchased from BD Biosciences (San Diego, CA, USA). BODIPY™ 581/591 C11 (D3861) was purchased from Thermo Fisher Scientific (Waltham, MA, USA). The MDA detection kit (S0131M) and the GSH/GSSG detection kit (S0053) were purchased from Beyotime (Shanghai, China). Primary antibodies, including anti-p-eIF2α (3398), were purchased from Cell Signaling Technology (Danvers, MA, USA). Anti-p-IRE1 (AP1146), ATF4 (A0201), and GPX4 (A1933) were purchased from Abclonal (Wuhan, China). Anti-CHOP (15204-1-AP), GAPDH (60004-1-Ig), Ki67 (27309-1-AP), HSPA5 (11587-1-AP), and beta actin (66009-1-Ig) were purchased from Proteintech (Wuhan, China).
Cell lines and cell culture
DLD1 and SW480 CRC cell lines were acquired from Procell Life Science & Technology Company (Wuhan, China). DLD1 cells and SW480 cells were cultured in RPMI 1640 medium (A1049101, Gibco, New York State, USA) and L15 medium (11415064, Gibco, New York State, USA), respectively. The media were supplemented with 10% fetal bovine serum (26010074, Gibco, New York State, USA) and 1% penicillin-streptomycin. The cell lines were incubated at 37°C with 5% CO2. The HSPA5 stable knockdown cells were constructed by infecting the cells with lentivirus encoding the shRNA targets to HSPA5 (WZ biosciences, Jinan, China). HSPA5-shRNA-1 (sequences: GTACCGGAGATTCAGCAACTGGTTAAAGCTCGAGCTTTAACCAGTTGCTGAATCTTTTTG); HSPA5-shRNA-2 (sequence: CCGGGAAATCGAAAGGATGGTTAATCTCGAGATTAACCATCCTTTCGATTTCTTTTTG). When the cells were 70% confluent, they were cultured with lentivirus mixed with polybrene (40804ES, Yeasen, China) for 48 h. Then, the cells were treated with 4 µg/mL puromycin to kill uninfected cells. The knockdown effect was examined via western blotting.
Western blot
The cells or tissues were lysed with lysis buffer (P0013C, Beyotime, Shanghai, China) supplemented with a phosphatase inhibitor (04906837001, Roche, Basel, Switzerland) and a protease inhibitor (04693159001, Roche, Basel, Switzerland). The cells were incubated on ice for 30 min. The cells centrifuged at 12000 rpm for 15 min and supernatant was collected. Protein concentration was determined using a BCA Protein Assay Kit (23225, Thermo, MA, US). Proteins were separated by 10% SDS-PAGE, and the protein bands were transferred to polyvinylidene fluoride membranes. The membranes were blocked with 5% non-fat milk and incubated with the target primary antibodies at 4°C overnight. Then, the membranes were washed with TBST buffer and were incubated with HRP goat anti-rabbit IgG (AS014, Abclonal, China) or HRP goat anti-mouse IgG (AS003, Abclonal, China) for 2 h at 25°C. Protein bands were scrutinized using Bio-Rad ChemiDocXRS+ (170–8265, Bio-Rad, California, USA).
Immunoprecipitation
The cells were lysed using a gentle lysis buffer (P0013, Beyotime, Shanghai, China) supplemented with a phosphatase inhibitor and a protease inhibitor. The supernatant was collected as described in the western blot Sect. 3 µg of primary antibodies anti-GPX4 or anti-HSPA5 to the supernatant were added and incubated at 4°C for 8 h. Protein A/G immunoprecipitation magnetic beads (B23201, Bimake, Texas, USA) were added and incubated for another 4 h. The beads were then collected and washed. Finally, the proteins were analyzed as described in the western blot section.
Immunohistochemistry
The harvested mouse tumor tissues were fixed in 4% paraformaldehyde. Tissue sections were deparaffinized using xylene. Different concentrations of ethanol were used to rehydrate these sections. The peroxide activity was repressed using 3% hydrogen peroxide and blocked the sections with 5% normal goat serum for 30 min at room temperature. The sections were then incubated overnight at 4°C with a primary antibody against Ki67 (27309-1-AP, Proteintech, Wuhan, China). Finally, the sections were stained with diaminobenzidine and haematoxylin.
Cell proliferation assay
A concentration of 1X104 DLD1 and SW480 cells were seeded into the wells of a 96-well plate. The cells were incubated in an incubator for 16 h. Pretreated cells with ZVAD-FMK (10 µM), necrosulfonamide (0.5 µM), chloroquine diphosphate (20 µM) or ferrostatin-1 (1 µM) for 2 h before treatment with indicated concentrations of erastin for 24 h. CCK-8 reagent was added to corresponding medias to generate a working solution (1:9). The medium was discarded, and the cells were washed with PBS gently for three times. The cells were incubated with CCK-8 working solution for 1.5 h and absorbance was measured at 450 nm.
Colony-formation assay
Concentrations of 7X102 DLD1 cells and 1X103 SW480 cells were seeded in 6-well plates. After incubation for 14 days, the cells were fixed in anhydrous methanol for 20 min at room temperature. Anhydrous methanol was discarded, and the cells were stained with 1% crystal violet buffer for 30 min at room temperature. The cells were washed with running water, and the colony formations were visualized.
Flow cytometry analysis
The control and Sh HSPA5 DLD1 and SW480 cells were seeded in 6-well plates and treated with 20 µM erastin for 24 h. The cells were harvested and washed three times with cold PBS. The cells were resuspended in 100 µM binding buffer and gently added with 5 µM Annexin V and 5 µM propidium iodide. Then, they were incubated for 30 min at the room temperature in the darkness. Finally, the cells were washed thrice with binding buffer, and apoptosis was analyzed using flow cytometry (FACSCalibur, BD, New Jersey, USA).
Quantitative real-time PCR
Total RNA was extracted from the erastin-treated cells using TRIzol® reagent (15596026, Thermo, Waltham, MA, USA) according to the manufacturer's protocol. The isolated RNA was transcribed into complementary DNA using a reverse transcription kit (206143, Qiagen, Dusseldorf, Germany). A 20 µL reaction system was utilized under the following cycling conditions: 95°C for 2 min, 45 cycles of 95°C for 20 s, and 58°C for 30 s. The dissociation step was used to generate a melting curve and to confirm the specificity of the amplification. Target gene expression was calculated using the 2‑ΔΔCT method, and GAPDH was applied as an internal control. The primer sequences were as follows: GAPDH, F: GACCTGCCGTCTAGAAAAAC; R: TTGAAGTCAGAGGAGACCAC. GPX4, F: ATACGCTGAGTGTGGTTTGC; R: CTTCATCCACTTCCACAGCG
Lipid ROS detection
DLD1 and SW480 cells were seeded in the 6-well plates and treated with 10 µM erastin for 6 h. The cells were stained with 1.5 µM BODIPY C11 (D3861, Thermo) for 30 min in an incubator. The media was removed, and the cells were gently washed with Hanks' Balanced Salt Solution (HBSS). Trypsin (1 mL) was added to each well, and the cells were harvested. The cells were centrifuged and medium was removed. Next, the cells were suspended with HBSS and were examined by flow cytometry (FACSCalibur, BD, New Jersey, USA).
MDA detection
MDA is a canonical product of ferroptosis. The MDA level is a good indicator of ferroptosis. The cells were harvested and lysed ~ 1\(\times\)107 cells using 1 mL lysis buffer (P0013, Beyotime, Shanghai, China). The cells were centrifuged, and the supernatant was harvested. The supernatant (100 µL) was mixed with 200 µL of MDA working solution (S0131M, Beyotime, Shanghai, China) in a 1.5 mL centrifuge tube and heated at 100°C for 15 min. The tubes were placed in water to cool them to room temperature. The tubes were centrifuged at 1000 g for 10 min, and the supernatant was harvested. The supernatant (200 µL) was added to the wells of 96-well plates, and the absorbance was measured at 532 nm.
GSH detection
The kit was purchased from Beyotime (S0053). The 1.5 mL tubes were weighed, and the treated cells were harvested. The weight of the cells (1 µg of cells is equivalent to 1 µL) was calculated and M solution was added to the cells (1:3) to remove protein. The tubes were frozen and thawed twice before centrifuging at 1000 g for 10 min at 4°C. The supernatant was harvested to determine total GSH levels. To test glutathione disulfide (GSSG) levels, the supernatant was added to GSH scavenging adjuvants (at a ratio of 1:5) and scavengers (at a ratio of 1:25). The solution was vortexed and incubated for 60 min at the room temperature to remove GSH. The sample was prepared to examine the GSSG levels. To test the total glutathione and GSSG, 10 µL of the prepared sample was added to 150 µL working solution and incubated for 5 min at room temperature. Then, 50 µL NADPH solution (0.5 mg/mL) was added to the mixed solution and absorbance was measured at 412 nm. The GSH level was calculated as follows: GSH = total glutathione GSSG ×2.
Animal studies
Male BALB/c nude mice (4–6 weeks) were purchased from the Air Force Medical University Laboratory Animal Center. The mice were kept in the SPF environment and had free access to food and water. 3X106 SW480 cells were injected subcutaneously into nude mice (n = 4 or 5). Erastin was dissolved in 5% DMSO/corn oil and intraperitoneally injected into nude mice at a dose of 15 mg/kg three times [16, 17]. Three weeks later, mice were anesthetized by intraperitoneal injection of 10% chloral hydrate (35 mg/kg). When mice were successfully anesthetized five minutes later, mice were sacrificed and the tumors were resected and weighed. The tumors were divided into two parts. One sample was lysed and used for protein analysis. The other part was used to test for Ki67 expression. All animal procedures were approved by the experimental animal ethics committee of Tangdu Hospital.
Gene Expression Omnibus (GEO) and the Cancer Genome Atlas dataset (TCGA) analysis
The GSE39582 dataset was downloaded from Gene Expression Omnibus (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=gse39582). The dataset was analyzed using the R software (version 4.0.3). The correlation between HSPA5 and PD-1, PD-L1, IDO1, LAG3 and CTLA4 in CRC TCGA dataset was analyzed using GEPIA2 (http://gepia2.cancer-pku.cn/#correlation)[18]. The correlation between HSPA5 and immune cell infiltration was analyzed using the TIMER2.0 (http://timer.cistrome.org/)[19].
Statistical analysis
All experimental data were analyzed as a mean estimate ± standard deviation of at least three independent replicates. The data between two groups were compared using the Student’s t-test. Data among three or more groups were compared using analysis of variance. The chi-square test was used to analyze the correlation between HSPA5 expression and clinicopathological parameters. Kaplan–Meier curves and log-rank tests were applied to explore the relationship between HSPA5 expression and overall survival. Receiver operating characteristic curve analysis was used to assess the diagnostic value of HSPA5. Statistical significance was set at p < 0.05. SPSS version 19.0 was used to analyze the experimental data (Chicago, IL, USA).