Next Article in Journal
Cost-Effectiveness Analysis of the Prophylactic Use of Ertapenem for the Prevention of Surgical Site Infections after Elective Colorectal Surgery
Next Article in Special Issue
Characterisation of Colistin -Resistant Enterobacterales and Acinetobacter Strains Carrying mcr Genes from Asian Aquaculture Products
Previous Article in Journal
Comparison of the Staphylococcal Chromosome Cassette (SCC) mec in Methicillin-Resistant Staphylococcus aureus (MRSA) and Non-aureus Staphylococci (MRNAS) from Animals and Humans
Previous Article in Special Issue
Genomic Characteristics of Colistin-Resistant Salmonella enterica subsp. enterica Serovar Infantis from Poultry Farms in the Republic of Serbia
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antibiotics
Volume 10
Issue 3
10.3390/antibiotics10030258
antibiotics-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Intestinal Carriage of Plasmid-Mediated Colistin-Resistant Enterobacteriaceae in Tertiary Care Settings

by
Jan Tkadlec
1,2,*,
Alzbeta Kalova
3,4,
Marie Brajerova
1,2,
Tereza Gelbicova
3,
Renata Karpiskova
3,
Eva Smelikova
1,2,
Otakar Nyc
1,2,
Pavel Drevinek
1,2 and
Marcela Krutova
1,2
1
Department of Medical Microbiology, 2nd Faculty of Medicine, Charles University, 150 06 Prague, Czech Republic
2
Department of Medical Microbiology, Motol University Hospital, 150 06 Prague, Czech Republic
3
Department of Microbiology and Antimicrobial Resistance, Veterinary Research Institute, 621 00 Brno, Czech Republic
4
Department of Experimental Biology, Faculty of Science, Masaryk University, 611 37 Brno, Czech Republic
*
Author to whom correspondence should be addressed.
Antibiotics 2021, 10(3), 258; https://doi.org/10.3390/antibiotics10030258
Submission received: 3 February 2021 / Revised: 1 March 2021 / Accepted: 2 March 2021 / Published: 4 March 2021
(This article belongs to the Special Issue Colistin Resistance: The Need for a One Health Approach)
Browse Figures
Versions Notes

Abstract

:
Background: In order to estimate the prevalence of plasmid borne colistin resistance and to characterize in detail the mcr-positive isolates, we carried out a sentinel testing survey on the intestinal carriage of plasmid-mediated colistin-resistant Enterobacteriaceae in hospitalized patients. Methods: Between June 2018 and September 2019, 1922 faecal samples from hospitalised patients were analysed by selective culture in presence of colistin (3.5 mg/L), and in parallel by direct detection of the mcr-1 to mcr-8 genes by qPCR. The mcr-positive isolates were characterised by whole-genome sequencing. Results: The prevalence of the mcr-1 gene was 0.21% (n = 4/1922); the mcr-2 to 8 genes were not detected. The mcr-1 gene was found to be localised in the IncX4 (n = 3) and IncHI2 (n = 1) plasmid type. One Escherichia coli isolate was susceptible to colistin due to the inactivation of the mcr-1 gene through the insertion of the IS2 element; however, the colistin resistance was inducible by culture in low concentrations of colistin. One human mcr-1 positive E. coli isolate was related genetically to the mcr-1 E. coli isolate derived from turkey meat of Czech origin. Conclusions: mcr-mediated colistin resistance currently poses little threat to patients hospitalised in Czech healthcare settings. The presence of the mcr-1 gene in the human population has a possible link to domestically produced, retail meat.

1. Introduction

Colistin is a polypeptide antibiotic belonging to the polymyxins. The outer membrane is a site of polymyxin interaction, which makes them effective against most Gram-negative bacteria [1]. However, due to its nephrotoxicity, colistin has had a limited use in human medicine; yet now, with the growing threat of the antimicrobial resistance, colistin has emerged as one of the last-resort antimicrobials for the treatment of infections caused by multidrug-resistant Gram-negative pathogens [2]. The resistance of Enterobacteriaceae to colistin began to be studied intensely following the emergence of plasmid-mediated colistin resistance encoded by the mcr-1 gene in China in 2015 [3]. To date, another nine mcr-genes have been identified [4], with mcr-10 being the latest [5]. However, the mcr-1 gene is the most frequently detected; yet the number of studies on the prevalence of the mcr-2 to mcr-10 genes is limited [6].
The occurrence of mcr-mediated colistin resistance is widespread, has been detected on all continents of the world, except for Antarctica, and has a variety of sources (human, animals, food of animal origin and the environment) [6]. Livestock, poultry and related food products have been identified as a reservoir for the spread of mcr genes carrying Enterobacteriaceae into humans [3]. The high prevalence of mcr-mediated colistin resistance in livestock has been linked to the extensive use of colistin in the veterinary sector and, when compared to human medicine, colistin has been used extensively for decades in the prevention and treatment of enterobacterial infections as well as a growth promoter [1,7]. While in Europe the veterinary use of polymyxins is monitored and regulated [8], in Asia, however, no such regulations exist, so colistin is produced and used predominantly [3]. The relationship between the agricultural use of colistin and the spread of plasmid-mediated colistin resistance was demonstrated by a Chinese study that detected a significant decrease (37% to 1%) of mcr gene prevalence among hospitalized patients after a ban on the agricultural use of colistin [9]. In addition, the intestinal carriage of mcr-1 was reported to have a high prevalence among people from rural areas in Bolivia (38.3%) [10] and Vietnam (20.6% and 65.31%, respectively) [11,12].
In Europe, the available data show that the prevalence of mcr-1 intestinal carriage in hospitalized patients is <1% [13,14,15,16,17]; however, in the community, the prevalence of mcr-gene carrying Enterobacteriaceae was found to be higher (4.9% and 11.4%) in cohorts of German and Dutch travellers [18,19].
Recently, Enterobacteriaceae with plasmids carrying the mcr-1 gene were detected in as much as 70% of tested retail meat samples in the Czech Republic [20], pointing to a possible source of colistin resistance, but little is known about the prevalence of the mcr-genes in humans. We aimed to estimate the prevalence of intestinal carriage of colistin-resistant Enterobacteriaceae with a detailed characterisation of the isolates carrying the mcr genes in patients of a large tertiary care hospital in the Czech Republic.

2. Results

2.1. The Prevalence of the mcr-1 Gene Was Low, and the mcr-2 to -8 Genes Were Not Detected

Between June 2018 and September 2019, 1922 samples (1657 rectal swabs and 265 stool samples) were investigated. Average age of the patient was 30 years (SD 29.06; range 1 day to 96 years), and 53.43% of the patients were males. The mcr-1 gene was detected in four enriched cultures; the prevalence of mcr-1 gene carriage was 0.21%. The mcr-2 to -8 genes were not detected.
After culture of the enriched cultures on chromogenic selective agar supplemented with colistin, 294 isolates of the Enterobacteriaceae were acquired, and the colistin resistance was confirmed in 131 isolates using the broth microdilution method; the prevalence of the gut carriage of colistin-resistant Enterobacteriaceae was 6.82% (Table 1).
In colistin-resistant Enterobacteriaceae, three mcr-1 positive E. coli were identified. Two of the mcr-1 positive isolates corresponded to the mcr-1 PCR-positive enrichment cultures. An additional mcr-1 positive E. coli strain was cultured from a PCR-negative enrichment culture.
The remaining two mcr-1 positive enrichments, with a subsequent negative culture on chromogenic selective media supplemented with colistin, were inoculated onto chromogenic media without colistin; one mcr-1 positive E. coli isolate (P1301A) was detected and found to be susceptible to colistin (MIC = 0.25 mg/L). The chromogenic culture-based prevalence of mcr-1 positive colistin resistant E. coli, after an enrichment and culture on selective media supplemented with colistin, was 0.16%. When the mcr-1 positive/colistin- susceptible isolate P1301A was included, the chromogenic culture-based prevalence of mcr-1 positive E. coli increased to 0.21%.
The production of MCR-1 phosphoethanolamine transferase was confirmed by lateral flow immunoassay in all of the colistin-resistant mcr-1 positive E. coli isolates (n = 3) except for one colistin-susceptible mcr-1 positive isolate (P1301A).
The MICs of other antimicrobials tested against the mcr-1 positive E. coli isolates are shown in Table 2.
Resistance mechanisms in mcr-1 to mcr-8 negative isolates were not studied.

2.2. Whole-Genome Analysis Data Revealed a High Diversity of mcr-1 Positive E. coli Isolates and the Predominance of the IncX4 Plasmid Type as a mcr-1 Gene Vector

The mcr-1 positive E. coli isolates belonged to four distinct sequence types, and cgMLST analysis revealed a high diversity of mcr-1 isolates in our study (Table 3). In silico bioinformatic analysis showed the corresponding acquired resistance genes or chromosomal mutations associated with the resistance phenotype, except for the colistin susceptible-mcr-1 positive isolate (Table 4).
The mcr-1 positive isolates carried multiple plasmids (Table 4). The mcr-1 gene was localised on the plasmid type IncHI2 (250 kb) in isolate P1519A, together with additional antimicrobial resistance genes (aadA1; aadA2b; aph(3′)-Ia; cmlA1; tet(A); and sul3). In another three isolates, the mcr-1 gene was localised in the IncX4 plasmids of 33–34 kb size, and no other resistance gene was found in that plasmid (Table 4).
To assess the diversity of the IncX4 plasmids detected in this study, the sequences of the plasmids were compared to a prototypic IncX4 plasmid pWI2-mcr (33,304 bp) available in the NCBI database (accession no LT838201) [23]. Using a MUSCLE alignment, the plasmid from P642A isolate (33,308 bp) showed a 99.99% identity to pWI2-mcr, for plasmids from the P732A (34,080 bp) and the P1301A (34,639 bp) isolates the identity was 100% with 97.7% and 96.1% coverage, respectively. The differences in the size of these plasmids compared to the prototypic pWI2-mcr were caused by the presence of insertion sequences in close proximity to the mcr-1 gene. In the isolate P732A, the IS1R (776 bp) element belonging to the IS1 family was inserted immediately before -35 position of the mcr promoter region. In the colistin-susceptible isolate P1301A, the promoter region of the mcr-1 gene was disrupted by the IS2 element (1336 bp) that separated the -35 and -10 boxes from the translation start (Figure 1).
Fasta files of hybrid assemblies for the E. coli isolates P642A; P732A; P1301A and P1519A are available at Mendeley data: doi: 10.17632/9pwrnrnx2n.1, accessed on 10 November 2020).

2.3. Colistin Resistance in the mcr-1 Positive/Colistin-Susceptible Isolate Was Inducible

To test the inducibility of colistin resistance in the isolate P1301A, we cultured the isolate in LB broth supplemented with colistin in concentrations ranging from 0.064 to 1 mg/L overnight at 37 °C. Bacterial growth was visible in all colistin concentrations tested, and using a lateral flow immunoassay, the presence of MCR-1 phosphoethanolamine transferase was detected in cultures with concentrations of colistin at 0.25 mg/L and higher.
Subsequent antimicrobial susceptibility testing of colistin showed an increase in MICs that exceeded the breakpoint of 2 mg/L up to 8 mg/L in isolates grown in concentrations of 0.25 mg/L and higher. In isolates grown in concentrations of 0.064; 0.125 mg/L and in controls cultured without colistin the MICs to colistin remained unchanged (0.25 mg/L).
To investigate the mechanism of the inducibility of colistin resistance in the isolate P1301A, the primers mcr1_137_F: CAGTATGGGATTGCGCAATGA and mcr1_891_R: AAGAAAACGGCAACACTCGC (Supplementary Table S3) were designed to amplify a region upstream of the mcr-1 containing promoter that controls MCR-1 production. Sanger sequencing of the PCR product was performed in subcultures of isolate P1301A where the colistin resistance was induced; the concentration of colistin in cultures was 0.25 mg/L and higher. Compared to the WGS data acquired from the same isolate, and before the induction of colistin resistance, the precise excision of IS2 without a target site duplication was found. The perfect restoration of the wild-type promoter region of the mcr-1 gene was the cause of the colistin resistance.

2.4. The Human mcr-1 E. coli Isolate Was Genetically Related to the mcr-1 E. coli Isolate from Turkey Meat Produced Domestically

Two human mcr-1 E. coli isolates (P732A, P1301A) were compared with six mcr-1 E. coli isolates derived from turkey meat [25] that have the same ST (744 or 69) and carry the mcr-1 gene in the same plasmid type (IncX4). Surprisingly, one human isolate (P732A) was related genetically to the mcr-1 E. coli isolate derived from domestically produced turkey meat (2096-17-B1) as demonstrated by a 10 allele difference in the 2513 loci of the cgMLST. Their genetic relatedness is also supported by the similarity of their resistance profiles at a phenotypic and genotypic level (Figure 2). The second human isolate (P1301A) demonstrated an 86 allele difference to the closest turkey-meat isolate excluding their close genetic relatedness. A close genetic relatedness was not found using the BacWGSTdb 2.0 database. The search results are shown in Supplementary Table S2.

3. Discussion

To the best of our knowledge, this is the first study to detect the human intestinal carriage of Enterobacteriaceae possessing the mcr-1 to -8 genes.
Compared to other studies that screened hospitalised patients, the prevalence of the mcr-1 gene in our study (0.21%) was found to be lower than that from study in Chinese tertiary hospitals in 2016, where the prevalence was 37.1% in 832 asymptomatic inpatients, and, in 2018, following a ban on the agricultural use of colistin, it was 1.38% in 654 inpatients [9]. An additional Chinese study reported that the prevalence of mcr-1 among hospitalised patients decreased from 14.3% in 4498 patients in 2016 to 6.3% in 5657 patients in 2019 [26]. Our results are in line with other European studies. In the Netherlands, the prevalence of the mcr-1 gene was found to be 0.35% in 576 patients [17], and in Paris (France) it was 0.58% out of 1217 patients from six hospitals [16]. The mcr-1 gene was not detected in 330 hospitalised patients from Slovenia, 258 healthcare workers from Spain, 653 patients from a university hospital in Western France or in 1144 healthy individuals and inpatients in Switzerland [13,14,15,27].
However, the above-mentioned studies did use different screening methodologies. Whilst some of the studies tested the samples using direct PCR detection [17] or enriched broths followed by selective culture of the PCR-positive samples [9,26], most of the European studies used a selective culture followed by a PCR or WGS detection of the mcr-genes in colistin-resistant isolates [13,14,15,16,27]; and none of the studies tested for the presence of the mcr-6 to -8 genes.
It is important to note that cultures on selective media supplemented with colistin (3.5 mg/L) resulted in the detection of 294 isolates; however, only 131 were confirmed to be colistin-resistant using the broth microdilution method (MIC >2 mg/L). In addition, the growth of colistin-susceptible isolates on selective media supplemented with colistin has been described in other studies [16,27]. This is probably caused by the poor diffusion of colistin through the agar, and it underlines the need to confirm colistin resistance in an isolate cultured on this type of media by broth microdilution.
In our study, only four of the 131 colistin resistant isolates carried the mcr-1 gene; the underlying mechanism of colistin resistance was not investigated in any of the remaining isolates. However, a higher MIC value was found in a majority of these isolates and is a characteristic of the resistance caused by chromosomal mutations affecting the synthesis of lipopolysaccharide (LPS), e.g., mutations in the two-component systems, PmrAB and PhoPQ, or in the regulatory protein MgrB that regulates modification of LPS [1].
In our study, exposure to low concentrations of colistin (0.25 mg/L and higher) led to a reactivation of the mcr-1 gene after the excision of the IS2 element from its promoter region in mcr-1 positive/colistin- susceptible E. coli. As we did not find the target site duplications after the IS2 excision, we think the precise excision of IS2, which was essential for the restoration of MCR-1 production, happens via a non-replicative transposition. Similar to our study, the precise excision of IS203v (which belongs to the same IS3 family as IS2 in this study) was described in E. coli O157:H7 where the Shiga toxin 2 was reversibly inactivated by IS203v [28]. The changes in MICs after culture with low concentrations of colistin have already been described in several isolates, including E. coli carrying the mcr-9 gene [29]; Shigella sonnei that was susceptible due to the inactivation of the mcr-1 gene through a 22 bp duplication within the gene [30]; and E. coli carrying an inactivated mcr-1 gene by the insertion of an IS1294b element [31]. A further two studies also reported an inactivated mcr-1 gene in E. coli; however, the inducibility of colistin resistance was not tested [32] or found to be unlikely due to the character of the genetic change [17].
Before our study, the detection of the mcr-1 and mcr-4 genes was reported in Czech clinical human isolates. From the 610 isolates collected between 2008 and 2018, eight (1.3%) mcr-1 and two (0.3%) mcr-4 positive isolates were found [33]. Unfortunately, the WGS data on isolates from this study are not available.
Another two human mcr-1 E. coli isolates were detected through an investigation of 177 stool samples of Czech travellers or expatriates residing temporarily in the Czech Republic. The isolates had different STs to the isolates detected in our study [34].
More importantly, the high prevalence of the mcr-1 gene (70.6 % and 21%) was found recently in two studies investigating imported and domestic raw, mainly poultry, meat products retailed in the Czech Republic [20,25]. It is interesting that the same E. coli sequence types, 744 and 69, which were identified in turkey meat imported to the Czech Republic from Poland, Brazil, Germany, and in turkey meat that originated in the Czech Republic [25], were also identified in our study in hospitalised patients. Furthermore, all the ST744 and ST69 isolates from the above-mentioned study carried the mcr-1 on the same IncX4 plasmid type.

4. Materials and Methods

4.1. Samples

Between June 2018 and September 2019, rectal swabs or faecal samples from patients (both adult and paediatric) hospitalised at the Motol University Hospital, Prague, were investigated. This hospital is a tertiary care hospital with 2200 beds and approximately 80,000 hospitalisations per year.

4.2. Screening for the mcr-Mediated Colistin Resistance

The rectal swabs or faecal samples were enriched in 5 mL Enterobacteriaceae enrichment broth (Mossel, Oxoid, UK) overnight at 37 °C. For direct detection of the mcr genes, DNA was extracted from 1 mL of the enriched cultures using a DNeasy® Blood & Tissue Kit (Qiagen, Germany). The mcr-genes 1 to 8 were detected by two SYBR® Green (Qiagen, Germany) based multiplex qPCR assays (CFX96 instrument, Bio-Rad Laboratories, Hercules, CA, USA), respectively. The primers and sequences for the synthetic DNA positive controls (GeneArt Strings, Thermo Fisher Scientific, Bremerhaven, Germany) were derived from previous studies reporting the mcr-1 to -8 genes [3,35,36,37,38,39,40,41] and are listed in Supplementary Table S3.
The enriched cultures were inoculated in parallel onto selective chromogenic agar Brilliance UTI Clarity agar (Oxoid, United Kingdom) supplemented with colistin (3.5 mg/L). Concentration of colistin was chosen on the basis of selective media developed by Nordmann et al. [21]. Suspected Enterobacteriaceae were identified using MALDI-TOF/MS Biotyper v 3.1 (Bruker Daltonics, Belgium). The isolates of intrinsically colistin-resistant Enterobacteriaceae (e.g., Proteus, Morganella, Providentia, etc.) were excluded from further analyses. Resistance to colistin was confirmed using the broth microdilution (BMD) method (Erba Mannheim, Germany), and a breakpoint of >2.0 mg/L was applied as recommended [42]. The susceptible E. coli ATCC 25922 and the colistin-resistant mcr-1 positive E. coli NCTC 13846 strains were used as a quality controls.
The colistin-resistant isolates of Enterobacteriaceae were tested for the presence of the mcr-genes as described above, and the mcr-positive isolates were characterised by whole-genome sequencing (WGS).
In the case of the mcr-1 positive enrichment by PCR, but negative culture on chromogenic selective media supplemented with colistin, the enrichment was inoculated on chromogenic media without colistin, and the grown colonies of Enterobacteriaceae were tested for the presence of the mcr-genes. The mcr-positive isolates were characterised as described above.

4.3. Whole-Genome Sequence Data Analysis of mcr-Positive Isolates

Short read sequencing was performed on a MiSeq sequencer (Illumina) after DNA sequencing library preparation using a Nextera XT DNA Library Preparation Kit (Illumina). For long read sequencing, a MinION NanoPore DNA technology (Oxford Nanopore Technologies (ONT) was applied. MinION libraries were prepared with a Ligation Sequencing Kit, #SQK-LSK109 (Oxford Nanopore Technologies (ONT)) and sequenced in a #FLO-MIN106 flow cell. Fast5 read files were base-called and converted to fastq format using Guppy v3.0.3+7e7b7d0 (ONT). The hybrid assembly of long and short reads was done using Unicycler v0.4.7 [23].
Bioinformatic analyses were performed using software tools available from the Centre for Genomic Epidemiology websites (https://cge.cbs.dtu.dk, accessed on 10 November 2020). MLST (Achtman and Pasteur) and core genome (cg) MLST were determined by MLST 2.0 and cgMLSTFinder 1.1 [43]. Serotype was defined by SerotypeFinder 2.0 [44]. Acquired antimicrobial resistance genes and mutations associated with antimicrobial resistance were identified using ResFinder 3.2 [45]. Plasmid classification was performed using PlasmidFinder 2.0 [46]. The phylogroup was determined using ClermonTyper [47], and IS elements were identified by ISfinder and ISsaga [48]. The sequence similarity between plasmid sequences was assessed by MUSCLE alignment using Geneious software v10.2.6.

4.4. Colistin Resistance Induction Assay in a mcr-Positive Colistin-Susceptible Isolate

The inducibility of colistin resistance was tested in the colistin-susceptible mcr-1 positive E. coli isolate. Briefly, the mcr-1 positive/colistin-susceptible E. coli isolate was cultured overnight on non-selective medium (Columbia blood agar). A bacterial suspension in saline (100 µL) adjusted to turbidity of 0.5 McFarland was inoculated, in triplicate, into 5 mL of LB broth (Luria Bertani, Oxoid, UK) containing colistin at concentrations of 0, 0.064, 0.125, 0.25, 0.5, and 1 mg/L and grown at 37 °C with an agitation of 200 rpm overnight (18 h). The culture grown in the LB broth was centrifuged using 4000 rpm for 10 min, and the minimum inhibitory concentration (MIC) to colistin was determined directly from the bacterial pellet according to the manufacturer’s instructions (Erba Mannheim, Germany).

4.5. Confirmation of MCR-1 Expression

To confirm the production of MCR-1 phosphoethanolamine transferase in the mcr-1 gene positive isolates, the NG-Test MCR-1 lateral flow immunoassay (Abbott, USA) was used according to the manufacturer’s instructions.

4.6. Antimicrobial Resistance Profile Determination

In addition, for the mcr-positive isolates, the MICs for 24 commonly used antimicrobials in Enterobacteriaceae infections were determined by the microdilution method (Erba Mannheim, Germany) using EUCAST breakpoints [42]. The Clinical laboratory standards institute (CLSI) breakpoints were used for tetracycline, cefoperazone and netilmicin, as the EUCAST does not define the values [49].

4.7. Comparative Analysis of Czech mcr-1 E. coli Isolates from Humans and Food of Animal Origin

To investigate the genetic relatedness between Czech mcr-1 positive isolates from humans (this study) and food of animal origin [25], the sequences of isolates revealing the same sequence type, and which carried the mcr-1 gene in the same plasmid type, were compared using core genome MLST (cgMLST) analysis comprising 2513 loci for E. coli in Ridom Seqsphere+ v7.2.0 (Ridom GmbH, Münster, Germany). Subsequently, a minimum spanning tree (MST), ignoring missing values, was constructed. The threshold cluster identification was 10 alleles according to the Ridom SeqSphere+ software.
In order to find genomes closely related to the mcr-positive isolates in this study, the BacWGSTdb 2.0 was used to perform the genomic epidemiological analysis [50].

5. Conclusions

To the best of our knowledge, this is the first study on the intestinal carriage of the mcr-1 to -8 genes in hospitalised patients. A low prevalence of the mcr-1 gene was identified, and the other mcr-genes were not detected. The mcr-1 positive E. coli isolates were genetically distinct; the IncX4 plasmid type was the most frequent mcr-1 gene vector. Our results indicate that, currently, mcr-mediated colistin resistance is of little threat to patients in Czech hospitals. The genetic relatedness of human and raw turkey meat mcr-1 E. coli isolates suggests that the dissemination of the mcr-1 gene has a possible link to the domestic production of retailed meat, but as to whether the source is of human or animal origin, or through meat contamination, needs to be investigated further. In terms of clinical practice, it should be highlighted that colistin resistance can be inducible in clinical isolates that carry the mcr-1 gene disrupted by IS element insertions.

Supplementary Materials

The following are available online at https://www.mdpi.com/2079-6382/10/3/258/s1, Table S1: Detailed annotation of plasmid IncX4-P1301A, Table S2: Genomic epidemiological analysis of relationship of mcr-positive isolates to available published genomes (based on cgMLST strategy), Table S3: The primers used to detect the mcr-1 to mcr-8 genes.

Author Contributions

Conceptualization: J.T., M.K., P.D. and O.N.; methodology, J.T., M.K. and R.K.; investigation, M.B., E.S., J.T., M.K., A.K. and T.G.; resources, J.T., M.K. and R.K.; data curation, J.T., M.K., A.K. and T.G.; writing—original draft preparation, J.T., M.K.; writing—review and editing, P.D., O.N., R.K., A.K., T.G.; visualization, M.K. and A.K.; supervision, P.D., O.N. and R.K.; project administration, J.T., M.K. and R.K.; funding acquisition, J.T., M.K. and R.K. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by Ministry of Health of the Czech Republic, grant nr. NV18-09-00254.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Part of the data were previously reported at the 30th European Congress of Clinical Microbiology and Infectious Diseases, 18–21 April 2020, Paris, France (Abstract no. 4183). The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Acknowledgments

We would like to thank Milena Antuskova, Katerina Farkasovska, Jana Prasilova, Barbora Dratvova and other laboratory staff of our department participating in conducting of this study.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Poirel, L.; Jayol, A.; Nordmann, P. Polymyxins: Antibacterial activity, susceptibility testing, and resistance mechanisms encoded by plasmids or chromosomes. Clin. Microbiol. Rev. 2017, 30, 557–596. [Google Scholar] [CrossRef]
  2. Skov, R.L.; Monnet, D.L. Plasmid-mediated colistin resistance (mcr-1 gene): Three months later, the story unfolds. Eurosurveillance 2016, 21, 30155. [Google Scholar] [CrossRef]
  3. Liu, Y.Y.; Wang, Y.; Walsh, T.R.; Yi, L.X.; Zhang, R.; Spencer, J.; Doi, Y.; Tian, G.; Dong, B.; Huang, X.; et al. Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: A microbiological and molecular biological study. Lancet Infect. Dis. 2016, 16, 161–168. [Google Scholar] [CrossRef]
  4. El-Sayed Ahmed, M.A.E.G.; Zhong, L.L.; Shen, C.; Yang, Y.; Doi, Y.; Tian, G.B. Colistin and its role in the Era of antibiotic resistance: An extended review (2000–2019). Emerg. Microbes Infect. 2020, 9, 868–885. [Google Scholar] [CrossRef] [PubMed]
  5. Wang, C.; Feng, Y.; Liu, L.; Wei, L.; Kang, M.; Zong, Z. Identification of novel mobile colistin resistance gene mcr-10. Emerg. Microbes Infect. 2020, 9, 508–516. [Google Scholar] [CrossRef]
  6. Nang, S.C.; Li, J.; Velkov, T. The rise and spread of mcr plasmid-mediated polymyxin resistance. Crit. Rev. Microbiol. 2019, 45, 131–161. [Google Scholar] [CrossRef]
  7. Shen, Y.; Zhou, H.; Xu, J.; Wang, Y.; Zhang, Q.; Walsh, T.R.; Shao, B.; Wu, C.; Hu, Y.; Yang, L.; et al. Anthropogenic and environmental factors associated with high incidence of mcr-1 carriage in humans across China. Nat. Microbiol. 2018, 3, 1054–1062. [Google Scholar] [CrossRef]
  8. European Medicines Agency. Sales of Veterinary Antimicrobial Agents in 31 European Countries in 2018: Trends from 2010 to 2018; Tenth European Surveillance of Veterinary Antimicrobial Consumption (ESVAC) Report; European Medicines Agency: Amsterdam, The Netherlands, 2020. [Google Scholar]
  9. Shen, C.; Zhong, L.-L.; Yang, Y.; Doi, Y.; Paterson, D.L.; Stoesser, N.; Ma, F.; El-Sayed Ahmed, M.A.E.-G.; Feng, S.; Huang, S.; et al. Dynamics of mcr-1 prevalence and mcr-1-positive Escherichia coli after the cessation of colistin use as a feed additive for animals in China: A prospective cross-sectional and whole genome sequencing-based molecular epidemiological study. Lancet Microbe 2020, 1, e34–e43. [Google Scholar] [CrossRef]
  10. Giani, T.; Sennati, S.; Antonelli, A.; Di Pilato, V.; Di Maggio, T.; Mantella, A.; Niccolai, C.; Spinicci, M.; Monasterio, J.; Castellanos, P.; et al. High prevalence of carriage of mcr-1-positive enteric bacteria among healthy children from rural communities in the Chaco region, Bolivia, september to october 2016. Eurosurveillance 2018, 23. [Google Scholar] [CrossRef] [PubMed]
  11. Trung, N.V.; Matamoros, S.; Carrique-Mas, J.J.; Nghia, N.H.; Nhung, N.T.; Chieu, T.T.B.; Mai, H.H.; Van Rooijen, W.; Campbell, J.; Wagenaar, J.A.; et al. Zoonotic transmission of mcr-1 colistin resistance gene from small-scale poultry farms, Vietnam. Emerg. Infect. Dis. 2017, 23, 529–532. [Google Scholar] [CrossRef] [PubMed]
  12. Yamamoto, Y.; Kawahara, R.; Fujiya, Y.; Sasaki, T.; Hirai, I.; Khong, D.T.; Nguyen, T.N.; Nguyen, B.X. Wide dissemination of colistin-resistant Escherichia coli with the mobile resistance gene mcr in healthy residents in Vietnam. J. Antimicrob. Chemother. 2019, 74, 523–524. [Google Scholar] [CrossRef]
  13. Germ, J.; Cerar Kišek, T.; Kokošar Ulčar, B.; Lejko Zupanc, T.; Mrvič, T.; Kerin Povšič, M.; Seme, K.; Pirs, M. Surveillance cultures for detection of rectal and lower respiratory tract carriage of colistin-resistant Gram-negative bacilli in intensive care unit patients: Comparison of direct plating and pre-enrichment step. J. Med. Microbiol. 2019, 68, 1269–1278. [Google Scholar] [CrossRef] [PubMed]
  14. Saly, M.; Jayol, A.; Poirel, L.; Megraud, F.; Nordmann, P.; Dubois, V. Prevalence of faecal carriage of colistin-resistant gram-negative rods in a university hospital in Western France, 2016. J. Med. Microbiol. 2017, 66, 842–843. [Google Scholar] [CrossRef]
  15. Fernández-Verdugo, A.; Forcelledo, L.; Rodríguez-Lozano, J.; Rodríguez-Lucas, C.; Barreiro-Hurlé, L.; Canut, A.; de la Iglesia, P.; Escudero, D.; Calvo, J.; Boga, J.A.; et al. Prospective multicentre study of rectal carriage of multidrug-resistant Enterobacteriaceae among health-care workers in Spain. Clin. Microbiol. Infect. 2020, 26, 649.e1–649.e4. [Google Scholar] [CrossRef]
  16. Bourrel, A.S.; Poirel, L.; Royer, G.; Darty, M.; Vuillemin, X.; Kieffer, N.; Clermont, O.; Denamur, E.; Nordmann, P.; Decousser, J.W. Colistin resistance in Parisian inpatient faecal Escherichia coli as the result of two distinct evolutionary pathways. J. Antimicrob. Chemother. 2019, 74, 1521–1530. [Google Scholar] [CrossRef]
  17. Terveer, E.M.; Nijhuis, R.H.T.; Crobach, M.J.T.; Knetsch, C.W.; Veldkamp, K.E.; Gooskens, J.; Kuijper, E.J.; Claas, E.C.J. Prevalence of colistin resistance gene (mcr-1) containing Enterobacteriaceae in feces of patients attending a tertiary care hospital and detection of a mcr-1 containing, colistin susceptible E. coli. PLoS ONE 2017, 12, e0178598. [Google Scholar] [CrossRef]
  18. von Wintersdorff, C.J.H.; Wolffs, P.F.G.; van Niekerk, J.M.; Beuken, E.; van Alphen, L.B.; Stobberingh, E.E.; Lashof, A.M.L.O.; Hoebe, C.J.P.A.; Savelkoul, P.H.M.; Penders, J. Detection of the plasmid-mediated colistin-resistance gene mcr-1 in faecal metagenomes of Dutch travellers. J. Antimicrob. Chemother. 2016, 71, 3416–3419. [Google Scholar] [CrossRef]
  19. Schaumburg, F.; Sertic, S.M.; Correa-Martinez, C.; Mellmann, A.; Köck, R.; Becker, K. Acquisition and colonization dynamics of antimicrobial-resistant bacteria during international travel: A prospective cohort study. Clin. Microbiol. Infect. 2019, 25, 1287.e1–1287.e7. [Google Scholar] [CrossRef] [PubMed]
  20. Gelbicova, T.; Kolackova, I.; Krutova, M.; Karpiskova, R. The emergence of mcr-1-mediated colistin-resistant Escherichia coli and Klebsiella pneumoniae in domestic and imported turkey meat in the Czech Republic 2017–2018. Folia Microbiol. 2020, 65, 211–216. [Google Scholar] [CrossRef] [PubMed]
  21. Nordmann, P.; Jayol, A.; Poirel, L. A universal culture medium for screening polymyxin-resistant gram-negative isolates. J. Clin. Microbiol. 2016, 54, 1395–1399. [Google Scholar] [CrossRef]
  22. Wick, R.R.; Judd, L.M.; Gorrie, C.L.; Holt, K.E. Unicycler: Resolving bacterial genome assemblies from short and long sequencing reads. PLoS Comput. Biol. 2017, 13, e1005595. [Google Scholar] [CrossRef]
  23. Beyrouthy, R.; Robin, F.; Lessene, A.; Lacombat, I.; Dortet, L.; Naas, T.; Ponties, V.; Bonnet, R. MCR-1 and OXA-48 in vivo acquisition in KPC-producing Escherichia coli after colistin treatment. Antimicrob. Agents Chemother. 2017, 61, 8–11. [Google Scholar] [CrossRef]
  24. Poirel, L.; Kieffer, N.; Brink, A.; Coetze, J.; Jayol, A.; Nordmann, P. Genetic features of MCR-1-producing colistin-resistant Escherichia coli isolates in South Africa. Antimicrob. Agents Chemother. 2016, 60, 4394–4397. [Google Scholar] [CrossRef]
  25. Gelbicova, T.; Barakova, A.; Florianova, M.; Jamborova, I.; Zelendova, M.; Pospisilova, L.; Kolackova, I.; Karpiskova, R. Dissemination and comparison of genetic determinants of mcr-mediated colistin resistance in Enterobacteriaceae via retailed raw meat products. Front. Microbiol. 2019, 10. [Google Scholar] [CrossRef]
  26. Wang, Y.; Xu, C.; Zhang, R.; Chen, Y.; Shen, Y.; Hu, F.; Liu, D.; Lu, J.; Guo, Y.; Xia, X.; et al. Changes in colistin resistance and mcr-1 abundance in Escherichia coli of animal and human origins following the ban of colistin-positive additives in China: An epidemiological comparative study. Lancet Infect. Dis. 2020, 20, 1161–1171. [Google Scholar] [CrossRef]
  27. Zurfluh, K.; Stephan, R.; Widmer, A.; Poirel, L.; Nordmann, P.; Nüesch, H.J.; Hächler, H.; Nüesch-Inderbinen, M. Screening for fecal carriage of MCR-producing Enterobacteriaceae in healthy humans and primary care patients. Antimicrob. Resist. Infect. Control. 2017, 6, 7–10. [Google Scholar] [CrossRef] [PubMed]
  28. Kusumoto, M.; Nishiya, Y.; Kawamura, Y. Reactivation of insertionally inactivated Shiga toxin 2 genes of Escherichia coli O157:H7 caused by nonreplicative transposition of the insertion sequence. Appl. Environ. Microbiol. 2000, 66, 1133–1138. [Google Scholar] [CrossRef] [PubMed]
  29. Kieffer, N.; Royer, G.; Decousser, J.W.; Bourrel, A.S.; Palmieri, M.; De La Rosa, J.M.O.; Jacquier, H.; Denamur, E.; Nordmann, P.; Poirel, L. mcr-9, an inducible gene encoding an acquired phosphoethanolamine transferase in Escherichia coli, and its origin. Antimicrob. Agents Chemother. 2019, 63. [Google Scholar] [CrossRef] [PubMed]
  30. Pham Thanh, D.; Thanh Tuyen, H.; Nguyen Thi Nguyen, T.; Chung The, H.; Wick, R.R.; Thwaites, G.E.; Baker, S.; Holt, K.E. Inducible colistin resistance via a disrupted plasmid-borne mcr-1 gene in a 2008 Vietnamese Shigella sonnei isolate. J. Antimicrob. Chemother. 2016, 71, 2314–2317. [Google Scholar] [CrossRef]
  31. Zhou, K.; Luo, Q.; Wang, Q.; Huang, C.; Lu, H.; Rossen, J.W.A.; Xiao, Y.; Li, L. Silent transmission of an IS1294b-deactivated mcr-1 gene with inducible colistin resistance. Int. J. Antimicrob. Agents 2018, 51, 822–828. [Google Scholar] [CrossRef] [PubMed]
  32. Liassine, N.; Assouvie, L.; Descombes, M.C.; Tendon, V.D.; Kieffer, N.; Poirel, L.; Nordmann, P. Very low prevalence of MCR-1/MCR-2 plasmid-mediated colistin resistance in urinary tract Enterobacteriaceae in Switzerland. Int. J. Infect. Dis. 2016, 51, 4–5. [Google Scholar] [CrossRef]
  33. Pomorska, K.; Jakubu, V.; Zelendova, M.; Dolejska, M.; Zemlickova, H. Detection of plasmid-determined colistin resistance mediated by mcr genes in the Czech Republic. Zpravy Cent. Epidemiol. A Mikrobiol. 2018, 27, 219–222. [Google Scholar]
  34. Krutova, M.; Kalova, A.; Nycova, E.; Gelbicova, T.; Karpiskova, R.; Smelikova, E.; Nyc, O.; Drevinek, P.; Tkadlec, J. The colonisation of Czech travellers and expatriates living in the Czech Republic by colistin-resistant Enterobacteriaceae and whole genome characterisation of E. coli isolates harbouing the mcr-1 genes on plasmid or chromosome: A cross-sectional study. Travel Med. Infect. Dis. 2021, 39, 101914. [Google Scholar] [CrossRef] [PubMed]
  35. Xavier, B.B.; Lammens, C.; Ruhal, R.; Kumar-Singh, S.; Butaye, P.; Goossens, H.; Malhotra-Kumar, S. Identification of a novel plasmid-mediated colistin- resistance gene, mcr-2, in Escherichia coli, Belgium, June 2016. Eurosurveillance 2016, 21, 6–11. [Google Scholar] [CrossRef] [PubMed]
  36. Yin, W.; Li, H.; Shen, Y.; Liu, Z.; Wang, S.; Shen, Z.; Zhang, R.; Walsh, T.R.; Shen, J.; Wang, Y. Novel plasmid-mediated colistin resistance gene mcr-3 in Escherichia coli. MBio 2017, 8, 4–9. [Google Scholar] [CrossRef] [PubMed]
  37. Carattoli, A.; Villa, L.; Feudi, C.; Curcio, L.; Orsini, S.; Luppi, A.; Pezzotti, G.; Magistrali, C.F. Novel plasmid-mediated colistin resistance mcr-4 gene in Salmonella and Escherichia coli, Italy 2013, Spain and Belgium, 2015 to 2016. Eurosurveillance 2017, 22, 30589. [Google Scholar] [CrossRef] [PubMed]
  38. Borowiak, M.; Fischer, J.; Hammerl, J.A.; Hendriksen, R.S.; Szabo, I.; Malorny, B. Identification of a novel transposon-associated phosphoethanolamine transferase gene, mcr-5, conferring colistin resistance in d-tartrate fermenting Salmonella enterica subsp. enterica serovar Paratyphi B. J. Antimicrob. Chemother. 2017, 72, 3317–3324. [Google Scholar] [CrossRef] [PubMed]
  39. AbuOun, M.; Stubberfield, E.J.; Duggett, N.A.; Kirchner, M.; Dormer, L.; Nunez-Garcia, J.; Randall, L.P.; Lemma, F.; Crook, D.W.; Teale, C.; et al. mcr-1 and mcr-2 variant genes identified in Moraxella species isolated from pigs in Great Britain from 2014 to 2015. J. Antimicrob. Chemother. 2017, 72, 2745–2749. [Google Scholar] [CrossRef]
  40. Yang, Y.Q.; Li, Y.X.; Lei, C.W.; Zhang, A.Y.; Wang, H.N. Novel plasmid-mediated colistin resistance gene mcr-7.1 in Klebsiella pneumoniae. J. Antimicrob. Chemother. 2018, 73, 1791–1795. [Google Scholar] [CrossRef]
  41. Wang, X.; Wang, Y.; Zhou, Y.; Li, J.; Yin, W.; Wang, S.; Zhang, S.; Shen, J.; Shen, Z.; Wang, Y. Emergence of a novel mobile colistin resistance gene, mcr-8, in NDM-producing Klebsiella pneumoniae. Emerg. Microbes Infect. 2018, 7, 122. [Google Scholar] [CrossRef]
  42. European Committee on Antimicrobial Susceptibility Testing. Testing Breakpoint Tables for Interpretation of MICs and Zone Diameters. 2020. Available online: https://eucast.org/clinical_breakpoints/ (accessed on 10 November 2020).
  43. Larsen, M.V.; Cosentino, S.; Rasmussen, S.; Friis, C.; Hasman, H.; Marvig, R.L.; Jelsbak, L.; Sicheritz-Ponten, T.; Ussery, D.W.; Aarestrup, F.M.; et al. Multilocus sequence typing of total-genome-sequenced bacteria. J. Clin. Microbiol. 2012, 50, 1355–1361. [Google Scholar] [CrossRef]
  44. Joensen, K.G.; Tetzschner, A.M.M.; Iguchi, A.; Aarestrup, F.M.; Scheutz, F. Rapid and easy in silico serotyping of Escherichia coli isolates by use of whole-genome sequencing data. J. Clin. Microbiol. 2015, 53, 2410–2426. [Google Scholar] [CrossRef] [PubMed]
  45. Zankari, E.; Hasman, H.; Cosentino, S.; Vestergaard, M.; Rasmussen, S.; Lund, O.; Aarestrup, F.M.; Larsen, M.V. Identification of acquired antimicrobial resistance genes. J. Antimicrob. Chemother. 2012, 67, 2640–2644. [Google Scholar] [CrossRef] [PubMed]
  46. Carattoli, A.; Zankari, E.; Garciá-Fernández, A.; Larsen, M.V.; Lund, O.; Villa, L.; Aarestrup, F.M.; Hasman, H. In silico detection and typing of plasmids using PlasmidFinder and plasmid multilocus sequence typing. Antimicrob. Agents Chemother. 2014, 58, 3895–3903. [Google Scholar] [CrossRef] [PubMed]
  47. Beghain, J.; Bridier-Nahmias, A.; Le Nagard, H.; Denamur, E.; Clermont, O. ClermonTyping: An easy-to-use and accurate in silico method for Escherichia genus strain phylotyping. Microb. Genom. 2018, 4, e000192. [Google Scholar] [CrossRef] [PubMed]
  48. Siguier, P.; Perochon, J.; Lestrade, L.; Mahillon, J.; Chandler, M. ISfinder: The reference centre for bacterial insertion sequences. Nucleic Acids Res. 2006, 34, D32–D36. [Google Scholar] [CrossRef] [PubMed]
  49. Clinical and Laboratory Standards Institute (CLSI). Performance Standards for Antimicrobial Susceptibility Testing, 27th ed.; Informational Supplement CLSI Document M100-S27; CLSI: Wayne, PA, USA, 2017. [Google Scholar]
  50. Feng, Y.; Zou, S.; Chen, H.; Yu, Y.; Ruan, Z. BacWGSTdb 2.0: A one-stop repository for bacterial whole-genome sequence typing and source tracking. Nucleic Acids Res. 2021, 49, D644–D650. [Google Scholar] [CrossRef]
Antibiotics 10 00258 g001 550
Figure 1. Genetic cause of colistin susceptibility in mcr-1 positive Escherichia coli isolate P1301A. (a) A comparison of the prototypic mcr-bearing IncX4 plasmid pWI2-mcr and a plasmid from the mcr-1 positive/colistin-susceptible E. coli isolate (P1301A). The plasmids were compared using a BRIG (Blast Ring Image Generator) v0.95, and annotation of the genes was done by Prokka v1.14.5 and RAST software (https://rast.theseed.org/FIG/rast.cgi, accessed on 10 November 2020). Hypothetical proteins not shown (Supplementary Table S1). (b) Details of the IS2 element insertion site in the promoter region of the mcr-1 gene of the prototypic pWI2-mcr plasmid. The insertion of the IS2 element into the IncX4 plasmid of the P1301A isolate lead to a separation of the -10 and +1 promoter regions and a silencing of mcr-1 expression. The sequence of the mcr-promoter was derived from the study of Poirel et al. [24].
Figure 1. Genetic cause of colistin susceptibility in mcr-1 positive Escherichia coli isolate P1301A. (a) A comparison of the prototypic mcr-bearing IncX4 plasmid pWI2-mcr and a plasmid from the mcr-1 positive/colistin-susceptible E. coli isolate (P1301A). The plasmids were compared using a BRIG (Blast Ring Image Generator) v0.95, and annotation of the genes was done by Prokka v1.14.5 and RAST software (https://rast.theseed.org/FIG/rast.cgi, accessed on 10 November 2020). Hypothetical proteins not shown (Supplementary Table S1). (b) Details of the IS2 element insertion site in the promoter region of the mcr-1 gene of the prototypic pWI2-mcr plasmid. The insertion of the IS2 element into the IncX4 plasmid of the P1301A isolate lead to a separation of the -10 and +1 promoter regions and a silencing of mcr-1 expression. The sequence of the mcr-promoter was derived from the study of Poirel et al. [24].
Antibiotics 10 00258 g001
Antibiotics 10 00258 g002 550
Figure 2. A comparison of the minimum spanning tree using a core genome MLST (cgMLST) analysis comprising 2513 loci for E. coli.
Figure 2. A comparison of the minimum spanning tree using a core genome MLST (cgMLST) analysis comprising 2513 loci for E. coli.
Antibiotics 10 00258 g002
Table
Table 1. Colistin minimal inhibitory concentration distribution in Enterobacteriaceae isolates grown on selective agar.
Table 1. Colistin minimal inhibitory concentration distribution in Enterobacteriaceae isolates grown on selective agar.
SpeciesResistant > 2 mg/L (EUCAST)
≤2 mg/L E4 mg/L8 mg/L≥16 mg/LTotal Resistant
Escherichia spp. (n = 84) A66441018
Klebsiella spp. (n = 132) B537116179
Enterobacter spp. (n = 47) C17−12930
Citrobacter spp. (n = 22) D20−2−2
Salmonella spp. (n = 9)7−2−2
Total (n = 294)1631120100131
A Including E. coli (n = 83) and one isolate of E. hermannii. B Including K. pneumoniae (n = 112); K. variicola (n = 15); K. oxytoca (n = 3); K. aerogenes (formerly Enterobacter aerogenes) (n = 2). C Including E. cloacae (n = 26); E. kobei (n = 16); E. asburiae (n = 4); E. ludwigii (n = 1). D Including C. freundii (n = 13); C. braakii (n = 4); C. koseri (n = 2); and one isolate each for C. amalonaticus, C. farmeri, C. murliniae. E The probable causes of the growth of colistin-susceptible bacteria on selective agar are i) non-homogenous distribution in agar; ii) binding of the drug to the plastic of the Petri dish; and iii) a high amount of susceptible bacteria in the inoculum [21].
Table
Table 2. The minimal inhibitory concentration (mg/L) of colistin and other antimicrobials with a detected resistance in the mcr-1 positive E. coli isolates.
Table 2. The minimal inhibitory concentration (mg/L) of colistin and other antimicrobials with a detected resistance in the mcr-1 positive E. coli isolates.
Isolate No.COL
(≥4)		AMP
(≥16)		AMS
(≥16/4)		CFZ
(≥8)		CXM
(≥16)		CPZ
(≥64)		PIP
(≥32)		TET
(≥16)		TGC
(≥1)		T/S
(≥8/152)		CIP
(≥1)		TOB
(≥4)		CMP
(≥16)
P642A4>12816/816168>128>321>4/760,518
P732A8>128128/64168>64>128>320.25>4/76>844
P1301A0.2522/124<0.5<1>320.250.25/4.7581>32
P1519A8>12864/32842>128>320.5>4/76>818
MIC was determined by broth microdilution (BMD) for ampicillin (AMP); ampicillin/sulbactam (AMS); cefazolin (CFZ); cefuroxime (CXM); aztreonam (AZT); gentamicin (GEN); amikacin (AMK); colistin (COL); trimethoprim/sulfamethoxazole (T/S); ciprofloxacin (CIP); chloramphenicol (CMP); tetracycline (TET); piperacillin (PIP); piperacillin/tazobactam (PIT); cefotaxime (CTX); ceftazidime (CAZ); cefoperazone (CPZ); cefoperazone/sulbactam (CPS); cefepime (CEP); meropenem (MER); ertapenem (ERT); tigecycline (TGC); netilmicin (NET); tobramycin (TOB). The breakpoints for resistance in mg/L are according to EUCAST (Clinical breakpoints v.10) and are in brackets. For tetracycline, netilmicin and cefoperazone, CLSI break-points were used since EUCAST does not define these values. All isolates were susceptible to amikacin, aztreonam, piperacillin/tazobactam, cefotaxime, ceftazidime, cefoperazone/sulbactam, cefepime, gentamicin, meropenem, ertapenem and netilmicin.
Table
Table 3. The epidemiological characteristics of mcr-1 positive samples/isolates.
Table 3. The epidemiological characteristics of mcr-1 positive samples/isolates.
Isolate/SampleIsolation (mm/yyyy)Dept.ST
Achtman/Pasteur 		cgMLSTSerotypePhylogroup
(Clermont Typing)
P224 *8/2018Children neurology−−−−
P642A10/2018Pneumology8778/7681202O9:H10A
P732A11/2018Anesthesiology and ICM69/371872O unknown: H18D
P1301A5/2019Children cardiology744/258727O unknown: H9A
P1519A7/2019Children surgery1193/5331972O18a:H5B2
* In sample P224, the mcr-1 gene was detected by PCR and confirmed by Sanger sequencing; it was not possible to culture the isolate carrying the mcr-1 gene.
Table
Table 4. Localisation of antimicrobial resistance (AMR) genes and mutations and virulence genes in genomes and plasmids of mcr-1 positive E. coli isolates.
Table 4. Localisation of antimicrobial resistance (AMR) genes and mutations and virulence genes in genomes and plasmids of mcr-1 positive E. coli isolates.
IsolateContig ASize (bp)Plasmids (PlasmidFinder 2.0)AMR Genes (ResFinder 3.2)AMR Mutations (ResFinder 3.2)Virulence Genes
(VirulenceFinder 2.0)
P642A14,726,579none (chromosome)mdf(A)nonegad; ireA; iss
2129,386IncFIB(AP001918); IncFII; IncQ1aadA1; aph(3″)-Ib; aph(6)-Id; blaTEM-1B; sul1; sul2; tet(A); dfrA1noneiroN; iss
347,696IncX1blaTEM-1B; qnrS1nonenone
433,308IncX4mcr-1.1nonenone
P732A15,262,918none (chromosome)mdf(A)parE p.S458A (FQ); parC p.S80I (FQ); gyrA p.S83L (FQ); gyrA p.D87N (FQ)air; eilA; gad; iss; lpfA
293,793not foundnonenonenone
385,283IncFIA; IncFIB(AP001918); IncQ1aac(3)-IId; aph(3″)-Ib; aph(6)-Id; catA1; sul2; tet(B)nonenone
434,080IncX4mcr-1.1nonenone
514,745not foundaadA5; blaTEM-1B; mph(A); sul1; dfrA17nonenone
68431not foundaph(3′)-Ianonenone
P1301A14,778,337IncQ1 B (chromosome)aph(3″)-Ib; aph(3′)-Ia; aph(6)-Id; mdf(A); catA1; sul2; tet(B)parC p.A56T; parC p.S80I; gyrA p.S83L; gyrA p.D87Ngad
289,356IncFIA;IncFIB(AP001918); IncFII(pCoo)nonenonenone
373,158IncFII(pCoo)tet(B)nonenone
434,639IncX4mcr-1.1nonenone
P1519A15,082,995none (chromosome)mdf(A)gyrA p.S83L; gyrA p.D87N; parC p.S80I; parE p.L416Fgad; iha; sat; vat
2250,486IncHI2; IncHI2Amcr-1.1; aadA1; aadA2b; aph(3′)-Ia; cmlA1; sul3; tet(A)nonenone
3110,729Col156; IncFIA; IncFIB(AP001918); IncQ1aph(3″)-Ib; aph(6)-Id; blaTEM-1B; mph(A); sul2; tet(B); dfrA17nonesenB
52113Col(BS512)nonenonenone
A The hybrid assembly of long and short reads was done using Unicycler v0.4.7. [22]. B The detection of IncQ1 presence in contig no. 1 corresponding to the genome of E. coli indicates plasmid integration into the chromosome of the host in isolate P1301A. The plasmids carrying mcr-1.1 gene are in bold.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Tkadlec, J.; Kalova, A.; Brajerova, M.; Gelbicova, T.; Karpiskova, R.; Smelikova, E.; Nyc, O.; Drevinek, P.; Krutova, M. The Intestinal Carriage of Plasmid-Mediated Colistin-Resistant Enterobacteriaceae in Tertiary Care Settings. Antibiotics 2021, 10, 258. https://doi.org/10.3390/antibiotics10030258

AMA Style

Tkadlec J, Kalova A, Brajerova M, Gelbicova T, Karpiskova R, Smelikova E, Nyc O, Drevinek P, Krutova M. The Intestinal Carriage of Plasmid-Mediated Colistin-Resistant Enterobacteriaceae in Tertiary Care Settings. Antibiotics. 2021; 10(3):258. https://doi.org/10.3390/antibiotics10030258

Chicago/Turabian Style

Tkadlec, Jan, Alzbeta Kalova, Marie Brajerova, Tereza Gelbicova, Renata Karpiskova, Eva Smelikova, Otakar Nyc, Pavel Drevinek, and Marcela Krutova. 2021. "The Intestinal Carriage of Plasmid-Mediated Colistin-Resistant Enterobacteriaceae in Tertiary Care Settings" Antibiotics 10, no. 3: 258. https://doi.org/10.3390/antibiotics10030258

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop