Retrospective Molecular Survey on Bacterial and Protozoan Abortive Agents in Roe Deer (Capreolus capreolus) from Central Italy
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Molecular Analyses
3. Results and Discussion
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Leclercq, S.O.; Cloeckaert, A.; Zygmunt, M.S. Taxonomic Organization of the Family Brucellaceae Based on a Phylogenomic Approach. Front. Microbiol. 2020, 10, 3083. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Coelho, A.C.; Díez, J.G.; Coelho, A.M. Risk Factors for Brucella spp. in Domestic and Wild Animals. In Updates on Brucellosis; Badour, M.M., Ed.; IntechOpen: London, UK, 2015; Available online: https://www.intechopen.com/chapters/49295 (accessed on 21 June 2022). [CrossRef] [Green Version]
- Di Francesco, A.; Donati, M.; Nicoloso, S.; Orlandi, L.; Baldelli, R.; Salvatore, D.; Sarli, G.; Cevenini, R.; Morandi, F. Chlamydiosis: Seroepidemiologic survey in a red deer (Cervus elaphus) population in Italy. J. Wildl. Dis. 2012, 48, 488–491. [Google Scholar] [CrossRef] [PubMed]
- Angelakis, E.; Raoult, D. Q fever. Vet. Microbiol. 2010, 140, 297. [Google Scholar] [CrossRef] [Green Version]
- Renter, D.G.; Gnad, D.P.; Sargeant, J.M.; Hygnstrom, S.E. Prevalence and Serovars of Salmonella in the Feces of Free-Ranging White-Tailed Deer (Odocoileus virginianus) in Nebraska. J. Wildl. Dis. 2006, 42, 699–703. [Google Scholar] [CrossRef] [Green Version]
- Dhama, K.; Karthik, K.; Tiwari, R.; Zubair Shabbir, M.; Barbuddhe, S.; Satya, V.S.M.; Singh, R.K. Listeriosis in animals, its public health significance (food-borne zoonosis) and advances in diagnosis and control: A comprehensive review. Vet. Q. 2015, 35, 211–235. [Google Scholar] [CrossRef]
- Lindsay, D.S.; Dubey, J.P. Neosporosis, Toxoplasmosis, and Sarcocystosis in Ruminants: An Update. Vet. Clin. N. Am. Food Anim. Pract. 2020, 36, 205–222. [Google Scholar] [CrossRef]
- Dubey, J.P.; Lindsay, D.S. A review of Neospora caninum and neosporosis. Vet. Parasitol. 1996, 67, 1–59. [Google Scholar] [CrossRef]
- Dubey, J.P.; Schares, G.; Ortega-Mora, L.M. Epidemiology and control of neosporosis and Neospora caninum. Clin. Microbiol. Rev. 2007, 20, 323–367. [Google Scholar] [CrossRef] [Green Version]
- Tirosh-Levy, S.; Savitsky, I.; Blinder, E.; Mazuz, M.L. The involvement of protozoan parasites in sheep abortions—A ten-year review of diagnostic results. Vet. Parasitol. 2022, 303, 109664. [Google Scholar] [CrossRef]
- Smith, N.C.; Goulart, C.; Hayward, J.A.; Kupz, A.; Miller, C.M.; van Dooren, G.G. Control of human toxoplasmosis. Int. J. Parasitol. 2021, 51, 95–121. [Google Scholar] [CrossRef]
- Hoye, T.T. Age determination in roe deer—A new approach to tooth wear evaluated on known age individuals. Acta Theriol. 2006, 51, 205–214. [Google Scholar] [CrossRef]
- Dos Santos, L.S.; Sá, J.C.; Dos Santos Ribeiro, D.L.; Chaves, N.P.; da Silva Mol, J.P.; Santos, R.L.; da Paixão, T.A.; de Carvalho Neta, A.V. Detection of Brucella sp. infection through serological, microbiological, and molecular methods applied to buffaloes in Maranhão State, Brazil. Trop. Anim. Health Prod. 2017, 49, 675–679. [Google Scholar] [CrossRef] [PubMed]
- Berri, M.; Rekiki, A.; Boumedine, K.S.; Rodolakis, A. Simultaneous differential detection of Chlamydophila abortus, Chlamydophila pecorum and Coxiella burnetii from aborted ruminant’s clinical samples using multiplex PCR. BMC Microbiol. 2009, 9, 130. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bhowmick, P.P.; Devegowda, D.; Karunasagar, I.; Veterinary, K. Virulotyping of seafood associated Salmonella enterica subsp. enterica isolated from Southwest coast of India. Res. Artic. Biotechnol. Bioinf. Bioeng. 2011, 1, 63–69. [Google Scholar]
- D’Agostino, M.; Wagner, M.; Vazquez-Boland, J.A.; Kuchta, T.; Karpiskova, R.; Hoorfar, J.; Novella, S.; Scortti, M.; Ellison, J.; Murray, A.; et al. A validated PCR-based method to detect Listeria monocytogenes using raw milk as a food model--towards an international standard. J. Food Prot. 2004, 67, 1646–1655. [Google Scholar] [CrossRef]
- Müller, N.; Zimmermann, V.; Hentrich, B.; Gottstein, B. Diagnosis of Neospora caninum and Toxoplasma gondii infection by PCR and DNA hybridization immunoassay. J. Clin. Microbiol. 1996, 34, 2850–2852. [Google Scholar] [CrossRef] [Green Version]
- Jones, C.D.; Okhravi, N.; Adamson, P.; Tasker, S.; Lightman, S. Comparison of PCR detection methods for B1, P30, and 18s rDNA genes of Toxoplasma gondii in aqueous humor. Investig. Ophthalmol. Vis. Sci. 2000, 41, 634–644. [Google Scholar]
- Camossi, L.G.; Greca-Júnior, H.; Corrêa, A.P.; Richini-Pereira, V.B.; Silva, R.C.; Da Silva, A.V.; Langoni, H. Detection of Toxoplasma gondii DNA in the milk of naturally infected ewes. Vet. Parasitol. 2011, 177, 256–261. [Google Scholar] [CrossRef]
- Dubey, J.P. Review of Neospora caninum and neosporosis in animals. Korean J. Parasitol. 2003, 41, 1–16. [Google Scholar] [CrossRef] [Green Version]
- Perrucci, S.; Guardone, L.; Altomonte, I.; Salari, F.; Nardoni, S.; Martini, M.; Mancianti, F. Apicomplexan Protozoa Responsible for Reproductive Disorders: Occurrence of DNA in Blood and Milk of Donkeys (Equus asinus) and Minireview of the Related Literature. Pathogens 2021, 10, 111. [Google Scholar] [CrossRef]
- Ebani, V.V.; Guardone, L.; Bertelloni, F.; Perrucci, S.; Poli, A.; Mancianti, F. Survey on the Presence of Bacterial and Parasitic Zoonotic Agents in the Feces of Wild Birds. Vet. Sci. 2021, 8, 171. [Google Scholar] [CrossRef]
- Reed, K.D.; Meece, J.K.; Henkel, J.S.; Shukla, S.K. Birds, migration and emerging zoonoses: West nile virus, lyme disease, influenza A and enteropathogens. Clin. Med. Res. 2003, 1, 5–12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Smith, O.M.; Snyder, W.E.; Owen, J.P. Are we overestimating risk of enteric pathogen spillover from wild birds to humans? Biol. Rev. Camb. Philos. Soc. 2020, 95, 652–679. [Google Scholar] [CrossRef] [Green Version]
- Bollettino Nazionale Epidemiologico Veterinario. Available online: https://www.izs.it/BENV_NEW/territori-ufficialmente-indenni_en.html (accessed on 20 September 2022).
- Garin-Bastuji, B.; Hars, J.; Drapeau, A.; Cherfa, M.A.; Game, Y.; Le Horgne, J.M.; Rautureau, S.; Maucci, E.; Pasquier, J.J.; Jay, M.; et al. Reemergence of Brucella melitensis in wildlife, France. Emerg. Infect. Dis. 2014, 20, 157–1571. [Google Scholar] [CrossRef]
- Godfroid, J.; Cloeckaert, A.; Liautard, J.P.; Kohler, S.; Fretin, D.; Walravens, K.; Garín Bastuji, B.; Letesson, J.J. From the discovery of the Malta fever’s agent to the discovery of a marine mammal reservoir, brucellosis has continuously been a re-emerging zoonosis. Vet. Res. 2005, 36, 313–326. [Google Scholar] [CrossRef] [Green Version]
- Conner, M.M.; Ebinger, M.R.; Blanchong, J.A.; Cross, P.C. Infectious disease in cervids of North America. Ann. N. Y. Acad. Sci. 2008, 1134, 146–172. [Google Scholar] [CrossRef] [PubMed]
- Berri, M.; Bernard, F.; Lecu, A.; Ollivet-Courtois, F.; Rodolakis, A. Molecular characterization and ovine live vaccine 1B evaluation toward a Chlamydophila abortus strain isolated from springbok antelope abortion. Vet. Microbiol. 2004, 103, 231–240. [Google Scholar] [CrossRef]
- Giovannini, A.; Cancellotti, F.M.; Turilli, C.; Randi, E. Serological investigation for some bacterial and viral pathogens in fallow deer (Cervus dama) and wild boar (Sus scrofa) of the San Rossore preserve, Tuscany, Italy. J. Wildl. Dis. 1988, 24, 127–132. [Google Scholar] [CrossRef] [PubMed]
- Giacometti, M.; Tolari, F.; Mannelli, A.; Lanfranchi, P. Seroepidemiologic investigations in the Alpine ibex (Capra i. ibex) of Piz Albris in the canton of Grigioni (Switzerland). Schweiz. Arch. Tierheilkd. 1995, 137, 537–542. [Google Scholar] [PubMed]
- Cubero-Pablo, M.J.; Plaza, M.; Pérez, L.; González, M.; León-Vizcaíno, L. Seroepidemiology of Chlamydial infections of wild ruminants in Spain. J. Wildl. Dis. 2000, 36, 35–47. [Google Scholar] [CrossRef] [Green Version]
- Salinas, J.; Caro, M.R.; Vicente, J.; Cuello, F.; Reyes-Garcia, A.R.; Buendía, A.J.; Rodolakis, A.; Gortázar, C. High prevalence of antibodies against Chlamydiaceae and Chlamydophila abortus in wild ungulates using two “in house” blocking-ELISA tests. Vet. Microbiol. 2009, 135, 46–53. [Google Scholar] [CrossRef] [PubMed]
- Foreyt, W.J.; Besser, T.E.; Lonning, S.M. Mortality in captive elk from salmonellosis. J. Wildl. Dis. 2001, 37, 399–402. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Trotta, A.; Del Sambro, L.; Galgano, M.; Ciccarelli, S.; Ottone, E.; Simone, D.; Parisi, A.; Buonavoglia, D.; Corrente, M. Salmonella enterica subsp. houtenae Associated with an Abscess in Young Roe Deer (Capreolus capreolus). Pathogens 2021, 10, 654. [Google Scholar] [CrossRef]
- Palacios-Gorba, C.; Moura, A.; Leclercq, A.; Gómez-Martín, Á.; Gomis, J.; Jiménez-Trigos, E.; Mocé, M.L.; Lecuit, M.; Quereda, J.J. Listeria spp. Isolated from Tonsils of Wild Deer and Boars: Genomic Characterization. Appl. Environ. Microbiol. 2021, 87, e02651-20. [Google Scholar] [CrossRef]
- Weindl, L.; Frank, E.; Ullrich, U.; Heurich, M.; Kleta, S.; Ellerbroek, L.; Gareis, M. Listeria monocytogenes in Different Specimens from Healthy Red Deer and Wild Boars. Foodborne Pathog Dis. 2016, 13, 391–397. [Google Scholar] [CrossRef]
- Eriksen, L.; Larsen, H.E.; Christiansen, T.; Jensen, M.M.; Eriksen, E. An outbreak of meningo-encephalitis in fallow deer caused by Listeria monocytogenes. Vet. Rec. 1988, 122, 274–276. [Google Scholar] [CrossRef] [PubMed]
- Tham, W.; Bannerman, E.; Bille, J.; Danielsson-Tham, M.L.; Eld, K.; Ericsson, H.; Gavier-Widén, D.; Rocourt, J.; Mörner, T. Listeria monocytogenes subtypes associated with mortality among fallow deer (Dama dama). J. Zoo Wildl. Med. 1999, 30, 545–549. [Google Scholar]
- Ebani, V.V.; Rocchigiani, G.; Bertelloni, F.; Nardoni, S.; Leoni, A.; Nicoloso, S.; Mancianti, F. Molecular survey on the presence of zoonotic arthropod-borne pathogens in wild red deer (Cervus elaphus). Comp. Immunol. Microbiol. Infect. Dis. 2016, 47, 77–80. [Google Scholar] [CrossRef] [PubMed]
- Rijks, J.M.; Roest, H.I.; van Tulden, P.W.; Kik, M.J.; IJzer, J.; Gröne, A. Coxiella burnetii infection in roe deer during Q fever epidemic, the Netherlands. Emerg. Infect. Dis. 2011, 17, 2369–2371. [Google Scholar] [CrossRef]
- Astobiza, I.; Barral, M.; Ruiz-Fons, F.; Barandika, J.F.; Gerrikagoitia, X.; Hurtado, A.; García-Pérez, A.L. Molecular investigation of the occurrence of Coxiella burnetii in wildlife and ticks in an endemic area. Vet. Microbiol. 2011, 147, 190–194. [Google Scholar] [CrossRef] [PubMed]
- González-Barrio, D.; Almería, S.; Caro, M.R.; Salinas, J.; Ortiz, J.A.; Gortázar, C.; Ruiz-Fons, F. Coxiella burnetii Shedding by Farmed Red Deer (Cervus elaphus). Transbound Emerg. Dis. 2015, 62, 572–574. [Google Scholar] [CrossRef] [PubMed]
- Fanelli, A.; Battisti, E.; Zanet, S.; Trisciuoglio, A.; Ferroglio, E. A systematic review and meta-analysis of Toxoplasma gondii in roe deer (Capreolus capreolus) and red deer (Cervus elaphus) in Europe. Zoonoses Public Health 2021, 68, 182–193. [Google Scholar] [CrossRef]
- San Miguel, J.M.; Gutiérrez-Expósito, D.; Aguado-Martínez, A.; González-Zotes, E.; Pereira-Bueno, J.; Gómez-Bautista, M.; Rubio, P.; Ortega-Mora, L.M.; Collantes-Fernández, E.; Álvarez-García, G. Effect of different ecosystems and management practices on Toxoplasma gondii and Neospora caninum infections in wild ruminants in Spain. J. Wildl. Dis. 2016, 52, 293–300. [Google Scholar] [CrossRef] [PubMed]
- De Craeye, S.; Speybroeck, N.; Ajzenberg, D.; Darde, M.L.; Collinet, F.; Tavernier, P.; Van Gucht, S.; Dorny, P.; Dierick, K. Toxoplasma gondii and Neospora caninum in wildlife: Common parasites in Belgian foxes and Cervidae? Vet. Parasitol. 2011, 178, 64–69. [Google Scholar] [CrossRef] [PubMed]
- Patel, K.K.; Burrows, E.; Heuer, C.; Asher, G.W.; Wilson, P.R.; Howe, L. Investigation of Toxoplasma gondii and association with early pregnancy and abortion rates in New Zealand farmed red deer (Cervus elaphus). Parasitol. Res. 2019, 118, 2065–2077. [Google Scholar] [CrossRef]
- Stollberg, K.C.; Schares, G.; Mayer-Scholl, A.; Hrushetska, I.; Diescher, S.; Johne, A.; Richter, M.H.; Bier, N.S. Comparison of Direct and Indirect Toxoplasma gondii Detection and Genotyping in Game: Relationship and Challenges. Microorganisms. 2021, 9, 1663. [Google Scholar] [CrossRef] [PubMed]
- Guardone, L.; Armani, A.; Mancianti, F.; Ferroglio, E. A Review on Alaria alata, Toxoplasma gondii and Sarcocystis spp. in Mammalian Game Meat Consumed in Europe: Epidemiology, Risk Management and Future Directions. Animals 2022, 12, 263. [Google Scholar] [CrossRef]
- Dubey, J.P.; Murata, F.H.A.; Cerqueira-Cézar, C.K.; Kwok, O.C.H. Epidemiologic and Public Health Significance of Toxoplasma gondii Infections in Venison: 2009–2020. J. Parasitol. 2021, 107, 309–319. [Google Scholar] [CrossRef] [PubMed]
- Stensgaard, A.S.; Sengupta, M.E.; Chriel, M.; Nielsen, S.T.; Petersen, H.H. Sero-prevalence and risk factors of Toxoplasma gondii infection in wild cervids in Denmark. Int. J. Parasitol. Parasites Wildl. 2022, 17, 288–294. [Google Scholar] [CrossRef] [PubMed]
- Gamarra, J.A.; Cabezon, O.; Pabon, M.; Arnal, M.C.; Luco, D.F.; Dubey, J.P.; Gortazar, C.; Almerıa, S. Prevalence of antibodies against Toxoplasma gondii in roe deer from Spain. Vet. Parasitol. 2008, 153, 152–156. [Google Scholar] [CrossRef]
- Malmsten, J.; Jakubek, E.B.; Björkman, C. Prevalence of antibodies against Toxoplasma gondii and Neospora caninum in moose (Alces alces) and roe deer (Capreolus capreolus) in Sweden. Vet. Parasitol. 2011, 177, 275–280. [Google Scholar] [CrossRef] [PubMed]
- Bártová, E.; Sedlák, K.; Pavlik, I.; Literak, I. Prevalence of Neospora caninum and Toxoplasma gondii antibodies in wild ruminants from the countryside or captivity in the Czech Republic. J. Parasitol. 2007, 93, 1216–1218. [Google Scholar] [CrossRef] [PubMed]
- Bártová, E.; Sedlák, K.; Budíková, M. A study of Neospora caninum and Toxoplasma gondii antibody seroprevalence in healthy cattle in the Czech Republic. Ann. Agric. Environ. Med. 2015, 22, 32–34. [Google Scholar] [CrossRef] [Green Version]
- Moskwa, B.; Kornacka, A.; Cybulska, A.; Cabaj, W.; Reiterova, K.; Bogdaszewski, M.; Steiner-Bogdaszewska, Z.; Bien, J. Seroprevalence of Toxoplasma gondii and Neospora caninum infection in sheep, goats, and fallow deer farmed on the same area. J. Anim. Sci. 2018, 96, 2468–2473. [Google Scholar] [CrossRef]
- Bártová, E.; Slezáková, R.; Nágl, I.; Sedlák, K. Neospora caninum and Toxoplasma gondii antibodies in red foxes (Vulpes vulpes) in the Czech Republic. Ann. Agric. Environ. Med. 2016, 23, 84–86. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.Y.; Li, J.J.; Wang, D.F.; Wei, Y.R.; Meng, X.X.; Tuerxun, G.; Bolati, H.; Liu, K.K.; Muhan, M.; Shahan, A.; et al. Seroprevalence of Five Zoonotic Pathogens in Wild Ruminants in Xinjiang, Northwest China. Vector Borne Zoonotic Dis. 2020, 20, 882–887. [Google Scholar] [CrossRef] [PubMed]
Pathogen | Target Gene | Primers Sequences (5′-3′) | Amplicons (bp) | Annealing Temperature | Ref. |
---|---|---|---|---|---|
Brucella spp. | bcsp31 | B4: TGGCTCGGTTGCCAATATCAA B5: CGCGCTTGCCTTTCAAGGTCTG | 223 | 60 °C | [13] |
Chlamydia abortus | pmp90/91 | pmp-F: CTCACCATTGTCTCAGGTGGA pmp-R821: ACCGTAATGGGTAGGAGGGGT | 821 | 63 °C | [14] |
Coxiella burnetii | IS1111 | Trans-1: TATGTATCCACCGTAGCCAGT Trans-2: CCCAACAACACCTCCTTATTC | 687 | 64 °C | [14] |
Listeria monocytogenes | prfA | LIP1: GATACAGAAACATCGGTTGGC LIP2a: GTGTAATCTTGATGCCATCAGG | 274 | 53 °C | [16] |
Neospora caninum | Nc5 | NP21: CTCGCCAGTCAACCTACGTCTTCT NP6: CCCAGTGCGTCCAATCCTGTAAC | 337 | 63°C | [17] |
Salmonella spp. | invA | invAF: GTTGTACCGTGGCATGTCTG invAR: GCCATGGTATGGATTTGTCC | 930 | 50 °C | [15] |
Toxoplasma gondii | B1 | B1outF: GGAACTGCATCCGTTCATGAG B1outR: TCTTTAAAGCGTTCGTGGTC | 193 | 57°C | [18] |
B1inF: TGCATAGGTTGCAGTCACTG B1inR: GGCGACCAATCTGCGAATACACC | 96 | 62.5 °C |
Roe Deer | |||
---|---|---|---|
Identification Number | Sex | Age | PCR Results |
RD4 | Male | Adult | Coxiella burnetii positive |
RD5 | Female | Adult | Toxoplasma gondii positive |
RD16 | Male | Young | Coxiella burnetii positive |
RD22 | Female | Adult | Coxiella burnetii positive |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ebani, V.V.; Trebino, C.; Guardone, L.; Bertelloni, F.; Cagnoli, G.; Altomonte, I.; Vignola, P.; Bongi, P.; Mancianti, F. Retrospective Molecular Survey on Bacterial and Protozoan Abortive Agents in Roe Deer (Capreolus capreolus) from Central Italy. Animals 2022, 12, 3202. https://doi.org/10.3390/ani12223202
Ebani VV, Trebino C, Guardone L, Bertelloni F, Cagnoli G, Altomonte I, Vignola P, Bongi P, Mancianti F. Retrospective Molecular Survey on Bacterial and Protozoan Abortive Agents in Roe Deer (Capreolus capreolus) from Central Italy. Animals. 2022; 12(22):3202. https://doi.org/10.3390/ani12223202
Chicago/Turabian StyleEbani, Valentina Virginia, Chiara Trebino, Lisa Guardone, Fabrizio Bertelloni, Giulia Cagnoli, Iolanda Altomonte, Paolo Vignola, Paolo Bongi, and Francesca Mancianti. 2022. "Retrospective Molecular Survey on Bacterial and Protozoan Abortive Agents in Roe Deer (Capreolus capreolus) from Central Italy" Animals 12, no. 22: 3202. https://doi.org/10.3390/ani12223202