Association of TCF7L2, CASC8 and GREM1 Polymorphisms in Patients with Colorectal Cancer and Type II Diabetes Mellitus
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Group
2.2. Genomic DNA Purification
2.3. Genotyping
2.4. Statistical Analysis
3. Results
3.1. General Characteristics of Patients
3.2. Genotype Distribution of rs7903146, rs6983267 and rs1696981 in Case and Control Groups
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Peters, U.; Jiao, S.; Schumacher, F.R.; Hutter, C.M.; Aragaki, A.K.; Baron, J.A.; Berndt, S.I.; Bézieau, S.; Brenner, H.; Butterbach, K.; et al. Colon Cancer Family Registry and the Genetics and Epidemiology of Colorectal Cancer Consortium. Identification of Genetic Susceptibility Loci for Colorectal Tumors in a Genome-Wide Meta-analysis. Gastroenterology 2013, 144, 799–807.e24. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lu, Y.; Kweon, S.-S.; Tanikawa, C.; Jia, W.-H.; Xiang, Y.-B.; Cai, Q.; Zeng, C.; Schmit, S.L.; Shin, A.; Matsuo, K.; et al. Large-Scale Genome-Wide Association Study of East Asians Identifies Loci Associated with Risk for Colorectal Cancer. Gastroenterology 2019, 156, 1455–1466. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Popescu, R.C.; Tocia, C.; Brînzan, C.; Cozaru, G.C.; Deacu, M.; Dumitru, A.; Leopa, N.; Mitroi, A.F.; Nicolau, A.; Dumitru, E. Molecular profiling of the colon cancer in South-Eastern Romania: Results from the MERCUR study. Medicine 2021, 100, e24062. [Google Scholar] [CrossRef] [PubMed]
- Singh, S.; Earle, C.C.; Bae, S.J.; Fischer, H.D.; Yun, L.; Austin, P.C.; Rochon, P.A.; Anderson, G.M.; Lipscombe, L. Incidence of Diabetes in Colorectal Cancer Survivors. J. Natl. Cancer Inst. 2016, 108, djv402. [Google Scholar] [CrossRef] [Green Version]
- Agache, A.; Bîrligea, A.; Botea, S.; Cirstea, M.; Mihalache, O.; Mustăţea, P. Assessment of the Risk of Colorectal Cancer in Patients with Diabetes Mellitus. Chirurgia 2021, 116, 620–626. [Google Scholar] [CrossRef]
- Tsilidis, K.K.; Kasimis, J.C.; Lopez, D.S.; Ntzani, E.E.; Ioannidis, J.P. Type 2 diabetes and cancer: Umbrella review of meta-analyses of observational studies. BMJ 2015, 350, g7607. [Google Scholar] [CrossRef] [Green Version]
- Peeters, P.J.; Bazelier, M.T.; Leufkens, H.G.; de Vries, F.; De Bruin, M.L. The risk of colorectal cancer in patients with type 2 diabetes: Associations with treatment stage and obesity. Diabetes Care 2015, 38, 495–502. [Google Scholar] [CrossRef] [Green Version]
- Cheng, I.; Caberto, C.P.; Lum-Jones, A.; Seifried, A.; Wilkens, L.R.; Schumacher, F.R.; Monroe, K.R.; Lim, U.; Tiirikainen, M.; Kolonel, L.N.; et al. Type 2 diabetes risk variants and colorectal cancer risk: The Multiethnic Cohort and PAGE studies. Gut 2011, 60, 1703–1711. [Google Scholar] [CrossRef]
- González, N.; Prieto, I.; del Puerto-Nevado, L.; Portal-Nuñez, S.; Ardura, J.A.; Corton, M.; Fernández-Fernández, B.; Aguilera, O.; Gomez-Guerrero, C.; Mas, S.; et al. 2017 update on the relationship between diabetes and colorectal cancer: Epidemiology, potential molecular mechanism and therapeutics implications. Oncotarget 2017, 8, 18456–18485. [Google Scholar] [CrossRef] [Green Version]
- Clevers, H.; Nusse, R. Wnt/β-catenin signaling and disease. Cell 2012, 149, 1192–1205. [Google Scholar] [CrossRef] [Green Version]
- Lan, F.; Yue, X.; Han, L.; Shi, Z.; Yang, Y.; Pu, P.; Yao, Z.; Kang, C. Genome-wide identification of TCF7L2/TCF4 target miRNAs revels a role for miR-21 in Wnt-driven epithelial cancer. Int. J. Oncol. 2012, 40, 519–526. [Google Scholar] [PubMed]
- Peng, S.; Zhu, Y.; Lü, B.; Xu, F.; Li, X.; Lai, M. TCF7L2 gene polymorphisms and type 2 diabetes risk: A comprehensive and updated meta-analysis involving 121,174 subjects. Mutagenesis 2013, 28, 25–37. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Akhundova, L.A.; RRustamova, Z.; RAlibayova, G.; Sh Mustafayev, N.; MHuseynova, I. Possible Role of rs7903146 Polymorphism of the Transcription Factor 7-Like 2 Gene in Genetic Predisposition to Type 2 Diabetes. Pak. J. Biol. Sci. 2022, 25, 218–225. [Google Scholar] [CrossRef] [PubMed]
- Hameed, T.; Khan, Z.; Imran, M.; Ali, S.; Albegali, A.A.; Ullah, M.I.; Ejaz, H. Associations of transcription factor 7-Like 2 (TCF7L2) gene polymorphism in patients of type 2 diabetes mellitus from Khyber Pakhtunkhwa population of Pakistan. Afr. Health Sci. 2021, 21, 15–22. [Google Scholar] [CrossRef] [PubMed]
- Bride, L.; Naslavsky, M.; Lopes Yamamoto, G.; Scliar, M.; Pimassoni, L.H.; Sossai Aguiar, P.; de Paula, F.; Wang, J.; Duarte, Y.; Passos-Bueno, M.R.; et al. TCF7L2 rs7903146 polymorphism association with diabetes and obesity in an elderly cohort from Brazil. PeerJ 2021, 9, e11349. [Google Scholar] [CrossRef] [PubMed]
- Zhang, M.; Tang, M.; Fang, Y.; Cui, H.; Chen, S.; Li, J.; Xiong, H.; Lu, J.; Gu, D.; Zhang, B. Cumulative evidence for relationships between multiple variants in the VTI1A and TCF7L2 genes and cancer incidence. Int. J. Cancer 2018, 142, 498–513. [Google Scholar] [CrossRef] [Green Version]
- Rosales-Reynoso, M.A.; Arredondo-Valdez, A.R.; Juárez-Vázquez, C.I.; Wence-Chavez, L.I.; Barros-Núñez, P.; Gallegos-Arreola, M.P.; Flores-Martínez, S.E.; Morán-Moguel, M.C.; Sánchez-Corona, J. TCF7L2 and CCND1 polymorphisms and its association with colorectal cancer in Mexican patients. Cell Mol. Biol. 2016, 62, 13–20. [Google Scholar]
- Karimi, F.; Amiri-Moghaddam, S.M.; Bagheri, Z.; Bahrami, A.R.; Goshayeshi, L.; Allahyari, A.; Mirsadraee, M.; Fanipakdel, A.; Bari, A.; Emadi-Torghabeh, A.; et al. Investigating the association between rs6983267 polymorphism and susceptibility to gastrointestinal cancers in Iranian population. Mol. Biol. Rep. 2021, 48, 2273–2284. [Google Scholar] [CrossRef]
- Tuupanen, S.; Turunen, M.; Lehtonen, R.; Hallikas, O.; Vanharanta, S.; Kivioja, T.; Björklund, M.; Wei, G.; Yan, J.; Niittymäki, I.; et al. The common colorectal cancer predisposition SNP rs6982367 at chromosome 8q24 confers potential to enhanced WNT signaling. Nat. Genet. 2009, 41, 885–890. [Google Scholar] [CrossRef] [Green Version]
- Lewis, A.; Freeman-Mills, L.; de la Calle-Mustienes, E.; Giráldez-Pérez, R.M.; Davis, H.; Jaeger, E.; Becker, M.; Hubner, N.C.; Nguyen, L.N.; Zeron-Medina, J.; et al. A polymorphic enhancer near GREM1 enfluences bowel cancer risk through differemtial CDX2 and TCF7L2 binding. Cell Rep. 2014, 8, 983–990. [Google Scholar] [CrossRef] [Green Version]
- Davis, H.; Irshad, S.; Bansal, M.; Rafferty, H.; Boitsova, T.; Bardella, C.; Jaeger, E.; Lewis, A.; Freeman-Mills, L.; Giner, F.C.; et al. Aberrant epithelial GREM1 expression initiates colonic tumorigenesis from cells outside the stem cell miche. Nat. Med. 2015, 21, 62–70. [Google Scholar] [CrossRef] [PubMed]
- World Health Organization; International Diabetes Federation. Definition and Diagnosis of Diabetes Mellitus and Intermediate Hyperglycaemia: Report of a WHO/IDF Consultation. 2006. Available online: https://apps.who.int/iris/handle/10665/43588 (accessed on 1 December 2020).
- National Institute on Alcohol Abuse and Alcoholism. Drinking Levels Defined. Available online: https://www.niaaa.nih.gov/alcohol-health/overview-alcohol-consumption/moderate-binge-drinking (accessed on 1 September 2020).
- Centers for Disease Control and Prevention. National Center for Health Statistics Tobacco Glossary. Available online: https://www.cdc.gov/nchs/nhis/tobacco/tobacco_glossary.htm (accessed on 1 September 2020).
- American Diabetes Association. 3. Foundation of Care and Comprehensive Medical Evaluation. Diabetes Care 2016, 39 (Suppl. 1), S23–S35. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- American Diabetes Association. Standards of Medical Care in Diabetes-2022. Diabetes Care 2022, 45 (Suppl. 1), S53–S54. [Google Scholar]
- Sainz, J.; Rudolph, A.; Hoffmeister, M.; Frank, B.; Brenner, H.; Chang-Claude, J.; Hemminki, K.; Försti, A. Effect of type 2 diabetes predisposing genetic variants on colorectal cancer risk. J. Clin. Endocrinol. Metab. 2012, 97, E847–E854. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Grant, S.F.; Thorleifsson, G.; Reynisdottir, I.; Benediktsson, R.; Manolescu, A.; Sainz, J.; Helgason, A.; Stefansson, H.; Emilsson, V.; Helgadottir, A.; et al. Variant of transcription factor 7-like 2(TCF7L2) gene confers risk of type 2 diaabets. Nat. Genet. 2006, 38, 320–323. [Google Scholar] [CrossRef]
- Ng, M.C.Y.; Shriner, D.; Chen, B.H.; Li, J.; Chen, W.M.; Guo, X.; Liu, J.; Bielinski, S.J.; Yanek, L.R.; Nalls, M.A.; et al. Meta-anlysis of genome wide association studies in African Americans provides inshints into the genetic architecture of type 2 diabetes. PLoS Genet. 2014, 10, e1004517. [Google Scholar] [CrossRef]
- Franceschini, N.; Shara, N.M.; Wang, H.; Voruganti, V.S.; Laston, S.; Haack, K.; Lee, E.T.; Best, L.G.; MacCluer, J.W.; Cochran, B.J.; et al. The association of genetic variants of type 2 diabetes with kidney function. Kidney Int. 2012, 82, 220–225. [Google Scholar] [CrossRef] [Green Version]
- Pomerantz, M.; Ahmadiyeh, N.; Jia, L.; Herman, P.; Verzi, M.P.; Doddapaneni, H.; Beckwith, C.A.; Chan, J.A.; Hills, A.; Davis, M.; et al. The 8q24 cancer risk variant rs6983267 demonstrates long interaction with MYC in colorectal cancer. Nat. Genet. 2009, 41, 882–884. [Google Scholar] [CrossRef] [Green Version]
- McKnight, A.J.; Patterson, C.C.; Pettigrew, K.A.; Savage, D.A.; Kilner, J.; Murphy, M.; Sadlier, D.; Maxwell, A.P.; Warren 3/UK Genetics of Kidneys in Diabetes (GoKinD) Study Group. A GREM1 gene variant associates with dibetic nephopaty. J. Am. Soc. Nephrol. 2010, 21, 773–781. [Google Scholar] [CrossRef] [Green Version]
- Folsom, A.R.; Pankow, J.S.; Peacokk, J.M.; Bielinski, S.J.; Heiss, G.; Boerwinkle, E. Variation in TCF7L2 and increase risk of colon cancer: The Atherosclerosis Risk in Communities (ARIC) Study. Diabetes Care 2008, 31, 905–909. [Google Scholar] [CrossRef] [Green Version]
SNP ID | VIC/FAM Sequences |
---|---|
rs7903146 | TAGAGAGCTAAGCACTTTTTAGATA[C/T]TATATAATTTAATTGCCGTATGAGG |
rs6983267 | GTCCTTTGAGCTCAGCAGATGAAAG[G/T]CACTGAGAAAAGTACAAAGAATTTT |
rs1696981 | TTTCTTTTTATCTTGATATCTTGCA[C/T]GCGGCCTAACAAAGGCAATAATAAC |
Variable | CRC + T2DM (n = 30) | Controls (n = 30) | p-Value |
---|---|---|---|
Age (years) | 69.90 ± 8.36 | 63.90 ± 11.9 | 0.250 |
Sex * | 0.193 | ||
Male | 19 (63.3) | 14 (46.7) | |
Female | 11 (36.7) | 16 (53.3) | |
BMI (kg/m2) | 30.75 ± 3.90 | 26.31 ± 5.23 | 0.036 |
Current of former smokers * | 9 (30) | 7 (23.3) | 0.049 |
Moderate alcohol consumption * | 6 (20) | 7 (23.3) | 0.072 |
Glu (mg/dL) | 143.29 ± 14.59 | 83.33 ± 12.87 | <0.001 |
Blood HbA1c (%) | 6.87 ± 0.96 | 5.16 ± 0.33 | <0.001 |
SBP (mmHg) | 136.98 ± 16.84 | 122.48 ± 11.26 | 0.042 |
DBP (mmHg) | 81.68 ± 0.97 | 69.88 ± 0.77 | <0.001 |
UA (mg/dL) | 39.7 ± 16.5 | 16.9 ± 9.3 | 0.018 |
Cr (mg/dL) | 1.13 ± 0.11 | 0.58 ± 0.26 | 0.029 |
Variable | Patients with CRC and T2DM (n = 30) | Percentage (%) |
---|---|---|
CEA (ng/mL) * | 50.51 | |
CA19-9 (U/mL) * | 43.15 | |
Tumor site | ||
Right colon | 7 | 23.3 |
Left colon | 14 | 46.7 |
Rectum | 9 | 30 |
Disease stage TNM | ||
Stage I | 8 | 26.7 |
Stage II | 8 | 26.7 |
Stage III | 12 | 40 |
Stage IV | 2 | 6.7 |
SNP | Univariate Analysis | Multivariate Analysis | ||||
---|---|---|---|---|---|---|
CRC + T2DM n = 30 | Controls n = 30 | p Value | OR [95%CI] | p Value | ||
rs7903146 | CC + CT TT | 21 (70) 9 (30) | 29 (96.7) 1 (3.3) | 0.003 | 0.080 [0.009–0.685] | 0.021 |
rs6983267 | GG + GT TT | 21 (70) 9 (30) | 25 (83.3) 5 (16.7) | 0.026 | 2.143 [0.622–7.387] | 0.227 |
rs16969681 | CC + CT TT | 22 (73.3) 8 (26.7) | 26 (86.7) 4 (13.3) | 0.009 | 2.364 [0.627–8.917] | 0.204 |
Genotype | CRC + T2DM (n = 30) | Controls (n = 30) | OR | 95% CI | p-Value |
---|---|---|---|---|---|
CC (%) | 8 (26.7%) | 18 (60%) | Reference | ||
CT (%) | 13 (43.3%) | 11 (36.7%) | 0.222 | 0.065–0.754 | 0.039 |
TT (%) | 9 (30%) | 1 (3.3%) | 2.042 | 0.395–10.553 | 0.011 |
C (%) | 29 (48.3%) | 47 (78.3%) | Reference | ||
T (%) | 31 (51.7%) | 13 (21.7%) | 3.865 | 1.743–8.567 | 0.001 |
Genotype | CRC + T2DM (n = 30) | Controls (n = 30) | OR | 95% CI | p-Value |
---|---|---|---|---|---|
GG (%) | 9 (30%) | 9 (30%) | Reference | ||
GT (%) | 12 (40%) | 16 (53.3%) | 3.000 | 0.586–15.362 | 0.586 |
TT (%) | 9 (30%) | 5 (16.7%) | 1.333 | 0.139–12.818 | 0.052 |
G (%) | 30 (50%) | 34 (56.7%) | Reference | ||
T (%) | 30 (50%) | 26 (43.3%) | 0.765 | 0.373–1.569 | 0.464 |
Genotype | CRC + T2DM (n = 30) | Controls (n = 30) | OR | 95% CI | p-Value |
---|---|---|---|---|---|
CC (%) | 15 (50%) | 19 (63.3%) | Reference | ||
CT (%) | 7 (23.3%) | 7 (23.3%) | 6.250 | 0.615–63.538 | 0.109 |
TT (%) | 8 (28.7%) | 4 (13.3%) | 7.000 | 0.397–23.347 | 0.047 |
C (%) | 37 (61.7%) | 45 (75%) | Reference | ||
T (%) | 23 (38.3%) | 15 (30%) | 0.536 | 0.245–1.173 | 0.116 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mitroi, A.F.; Leopa, N.; Dumitru, E.; Brînzan, C.; Tocia, C.; Dumitru, A.; Popescu, R.C. Association of TCF7L2, CASC8 and GREM1 Polymorphisms in Patients with Colorectal Cancer and Type II Diabetes Mellitus. Genes 2022, 13, 1297. https://doi.org/10.3390/genes13081297
Mitroi AF, Leopa N, Dumitru E, Brînzan C, Tocia C, Dumitru A, Popescu RC. Association of TCF7L2, CASC8 and GREM1 Polymorphisms in Patients with Colorectal Cancer and Type II Diabetes Mellitus. Genes. 2022; 13(8):1297. https://doi.org/10.3390/genes13081297
Chicago/Turabian StyleMitroi, Anca Florentina, Nicoleta Leopa, Eugen Dumitru, Costel Brînzan, Cristina Tocia, Andrei Dumitru, and Răzvan Cătălin Popescu. 2022. "Association of TCF7L2, CASC8 and GREM1 Polymorphisms in Patients with Colorectal Cancer and Type II Diabetes Mellitus" Genes 13, no. 8: 1297. https://doi.org/10.3390/genes13081297