Next Article in Journal
The Role of Diffusivity in Oil and Gas Industries: Fundamentals, Measurement, and Correlative Techniques
Previous Article in Journal
A Review of Lithium-Ion Battery Thermal Runaway Modeling and Diagnosis Approaches
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Processes
Volume 10
Issue 6
10.3390/pr10061193
processes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Proteomics Analysis of Zygosaccharomyces mellis in Response to Sugar Stress

by
Xiaolan Xu
1,2,*,†,
Yuxuan Zhu
2,3,†,
Yujie Li
2,3,
Wenchao Yang
1,2,
Hao Zhou
2,3 and
Xinchao Chen
2,3
1
College of Animal Science (College of Bee Science), Fujian Agriculture and Forestry University, Fuzhou 350002, China
2
State and Local Joint Engineering Laboratory of Natural Biotoxins, Fuzhou 350002, China
3
College of Food science, Fujian Agriculture and Forestry University, Fuzhou 350002, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Processes 2022, 10(6), 1193; https://doi.org/10.3390/pr10061193
Submission received: 2 April 2022 / Revised: 7 June 2022 / Accepted: 10 June 2022 / Published: 15 June 2022
(This article belongs to the Section Biological Processes and Systems)
Browse Figures
Versions Notes

Abstract

:
The high-osmotic-pressure environment of honey is not suitable for the survival of microorganisms, except for osmotic-tolerant fungal and bacterial spores. In this study, shotgun metagenomic sequencing technology was used to identify yeast species present in honey samples. As a result, Zygosaccharomyces spp. yeast, including Zygosaccharomyces rouxii, Z. mellis and Z. siamensis, were isolated. The intracellular trehalose and glycerin concentrations of yeast, as well as the antioxidant-related CAT, SOD and POD enzyme activities, increased under a high-glucose environment (60%, w/v). To learn more about the osmotic resistance of Z. mellis, iTRAQ-based proteomic technology was used to investigate the related molecular mechanism at the protein level, yielding 522 differentially expressed proteins, of which 303 (58.05%) were upregulated and 219 (41.95%) were downregulated. The iTRAQ data showed that the proteins involved in the pathway of the cell membrane and cell-wall synthesis, as well as those related to trehalose and glycerin degradation, were all downregulated, while the proteins in the respiratory chain and TCA cycle were upregulated. In addition, formate dehydrogenase 1 (FDH1), which is involved in NADH generation, displayed a great difference in response to a high-sugar environment. Furthermore, the engineered Saccharomyces cerevisiae strains BY4741△scFDH1 with a knocked-out FDH1 gene were constructed using the CRISPR/Cas9 method. In addition, the FDH1 from Z. mellis was expressed in BY4741△scFDH1 to construct the mutant strain BY4717zmFDH1. The CAT, SOD and POD enzyme activities, as well as the content of trehalose, glycerin, ATP and NADH, were decreased in BY4741△scFDH1. However, those were all increased in BY4717zmFDH1. This study revealed that Z. mellis could increase the contents of trehalose and glycerin and promote energy metabolism to improve hypertonic tolerance. In addition, FDH1 had a significant effect on yeast hypertonic tolerance.

1. Introduction

Honey is a natural and stable sweetener that is primarily composed of sugars (70–85%), including fructose, sucrose, glucose, maltose, raffinose and others [1]. Due to high osmotic stress, most microbes cannot survive in honey, except osmotolerant and halotolerant microorganisms, such as yeast Zygosaccharomyces spp., which can cause food spoilage. These yeasts are found in a wide range of sugary foods, including fruit juices, wine and honey [2], leading to economic losses in food manufacture and health hazard. Among these species, Z. rouxii has been extensively studied for its osmotic tolerance in food fermentation under high sugar or high salt stress. Another yeast isolated from honey, Z. mellis, also has remarkably high sugar tolerance [3]. Exploring the molecular mechanisms of resistance under high sugar stress is helpful for developing strategies for food production. Although previous studies have reported the isolation and identification of Z. mellis and the effect of a high-glucose environment on the transcription expression profile, there is a lack of in-depth studies on its hypertonic resistance [4,5,6]. iTRAQ-based proteomic technology could screen differentially expressed proteins (DEPs) that are involved in cell biological processes and help us to better understand the hypertonic mechanism of Z. mellis.
The metabolic pathways and response mechanisms of yeasts, especially Z. rouxii and Saccharomyces cerevisiae, under high osmotic conditions have been widely reported [7,8,9]. The content of major metabolites in the stress response in yeast, including glycerin, trehalose, D-arabinol and erythritol, is increased under the stress of high concentrations of sugar, NaCl and ethanol [7,10]. At the same time, cells can adapt to stress by regulating the activity of superoxide dismutase (SOD), intracellular peroxidase, adenosine triphosphatase (ATPase) and mitochondrial ATPase [11]. In addition, the high osmolarity glycerol mitogen-activated protein kinase (HOG- MAPK) pathway, which plays a crucial role in signal transduction in yeast, can promote glycerin accumulation and regulate other physiological processes [12,13].
With the development of genomics, proteomics and other molecular technologies, the tolerance mechanisms of yeast can also be studied from a comprehensive perspective at the protein level. For example, in Z. rouxii, the proteins involved in carbohydrate and energy metabolism, amino acid metabolism, response to stimulus, etc., were shown to be regulated in response to high sugar concentrations [14]. Unlike Z. rouxii, under stationary-phase stress conditions, the cell replication, oxidative stress responses and proteolytic activity of S. cerevisiae were decreased, whereas cell-wall renewal, the regulation of solute transport across the cell membrane and de novo arginine synthesis were enhanced [15]. The metabolic processes of Z. rouxii and S. cerevisiae have been well reported; however, there was few reports on the mechanism of osmo-tolerance in Z. mellis. Due to the different and extremely complex metabolic processes, the mechanisms of other yeasts adapted to high-sugar environments need to be further studied.
DNA metabarcoding is a high-throughput molecular identification approach for identifying mixed samples from plants, animals or fungi [16,17]. In this study, the yeasts isolated from honey were identified by DNA barcoding and metabarcoding. Furthermore, the mechanism associated with the sugar tolerance of Z. mellis was investigated by proteomic techniques. The findings contribute to a better understanding of the high sugar tolerance features of Z. mellis.

2. Materials and Methods

2.1. Isolation and Identification of Honey Samples

A total of 39 honey samples were collected from apiaries in different areas in China (Table S1). The yeasts in each honey sample were identified by the DNA metabarcoding technique [18]. Firstly, the honey was diluted with sterile water and centrifuged at 9000 rpm for 10 min at 4 °C. Then, the total genomic DNA of yeasts from each sample was extracted using TIANamp Yeast DNA Kit (TIANGEN Biotech Co., Ltd., Beijing, China). The primers ITS1 and ITS2 (Table 1) were used for PCR amplification, which was carried out with Phusion® High-Fidelity PCR Master Mix (NEB, Ipswich, MA, USA). The mixed PCR products were purified with a GeneJET Gel Extraction Kit (Thermo Fisher Scientific, San Jose, CA, USA). Sequencing libraries were generated using the Next®Ultra™ DNA Library Prep Kit (NEB, Ipswich, Massachusetts, USA ), including the processes of input-DNA fragmentation, end repair, 5′ phosphorylation and dA-Tailing, adaptor ligation, U excision, magnetic-beads purification and PCR enrichment. Finally, the library was sequenced on an Illumina MiSeq platform (Illumina, San Diego, CA, USA). Paired-end reads from the original DNA fragments were merged using FLASH (fast length adjustment of short reads) software to produce longer reads [19]. At last, paired-end reads were assigned to each sample according to the unique barcodes.
Furthermore, the isolated yeasts were cultured on yeast extract–peptone–dextrose (YPD) agar plates at 30 °C for 2 days. In addition, the amount of yeast was counted according to the method described in “National food safety standard—honey” in China (GB 14963-2011). Then, the single yeast colony was selected and incubated in YPD medium at 30 °C for 2 days. The identification of a single yeast colony was performed using DNA barcoding based on the internal transcribed spacer (ITS) sequence method with the primers ITS1 and ITS2 (Table 2). To validate the species of the isolated yeast, the ITS sequences were compared with those in the GenBank database (Accession number: 12683468) using the BLAST search program (https://www.ncbi.nlm.nih.gov/, accessed on 9 November 2018).

2.2. Growth Curve Measurements

Yeast was cultured with yeast extract–peptone–dextrose (YPD) medium containing 30% glucose (w/v) at 30 °C with shaking at 180 rpm for 12–16 h until the cell density reached 2 × 108 CFU/mL. An amount of 7% of the inoculation volume was added to YPD medium containing 60% glucose or 2% glucose, respectively. In addition, the latter was used as control. Then, the yeast was cultured at 30 °C with shaking at 180 rpm, and the biomass of the yeast was assessed every 8 h, or the OD values were assessed every 6 h. The sample in logarithmic phase was used in the following experiment.

2.3. POD, SOD and CAT Enzyme Activities Determination

The culture solution at 24 h was centrifuged at 9000 rpm for 10 min at 4 °C, after which the yeast cells were washed with PBS 4 times and then suspended in PBS at a concentration of 2 × 109 CFU/mL. The enzyme activities of peroxidase (POD), superoxide dismutase (SOD) and catalase (CAT) were assayed according to the kit instructions of the POD activity assay kit (BC0090), SOD activity assay kit (BC0170) and CAT activity assay kit (BC0200), respectively (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China).

2.4. Glycerol and Trehalose Content Determination

To create a standard curve for determining glycerol concentration, 0.0, 0.25, 1.0, 1.5 and 2.0 mL of glycerol at a concentration of 0.03 mg/mL were adjusted to 2 mL by adding sterile water, respectively, and then reacted with acetylacetone solution (1.2 mL) and acetylacetone solution (1.2 mL) in a 70 °C water bath for 1 min. The OD values of the mixture were detected at 410 nm [20]. The standard curve obtained was y = 19.282x + 0.0356 (R2 = 0.991). The yeast that was cultured for 24 h was washed with sterile water 4 times and then centrifuged at 4 °C and 9000 rpm for 10 min. After freezing and thawing 3 times, the supernatant was used for the determination of glycerol.
To create a standard curve for determining trehalose content, 0.0, 0.5, 1.0, 2.0 and 3.0 mL of trehalose (1 g/L) were mixed with trichloroacetic acid (0.5 m, 4 mL) and were then adjusted to 25 mL by adding sterile water, respectively. Then, 1 mL of each sample was mixed with 5 mL of anthrone–sulfuric acid (2 g/L), and the mixture reacted in boiling water for 10 min. The OD values of the samples were detected at 410 nm [21]. The standard curve obtained was y = 6.2746x + 0.0442 (R2 = 0.9993). Yeasts were treated with trichloroacetic acid (0.5 M) on ice for 1 h to extract intracellular trehalose and then centrifuged at 4 °C and 14,000 rpm for 10 min. After the supernatant was mixed with trichloroacetic acid (0.5 M), each sample was reacted with anthrone–sulfuric acid in boiling water for 10 min, and the solution was then used for the determination of trehalose content.

2.5. iTRAQ Experiment

The yeast suspensions were centrifuged at 9500 rpm for 10 min at 4 °C, and the yeast cells were washed with sterile water 3 times. Proteins were extracted using lysis buffer (8 M urea, 40 mM Tris-HCl, 2 mM EDTA and 10 mM DTT, pH 8.5) and magnetic beads (diameter 5 mm). After the mixture was put in a TissueLyser for 2 minutes at 50 Hz and then centrifugated with 25,000× g at 4 for 20 min, the supernatant was reduced with 10 mM dithiothreitol at 56 °C for 1 h and alkylated by 55 mM iodoacetamide for 20 min. The mixture was centrifugated, and the supernatant containing the proteins was obtained. After the extracted protein was digested with Trypsin Gold (Promega, Madison, WI, USA), peptides were desalted with a Strata X C18 column (Phenomenex, Torrance, CA, USA). Then, the peptides were dissolved in 30 μL 0.5 M TEAB and combined with the iTRAQ labeling reagents in the iTRAQ Reagent 8-plex Kit (Sigma Aldrich Inc., St. Louis, MI, USA).
The labelled peptides were separated with an LC-20AB HPLC Pump system, which was coupled with a high pH RP column (Shimadzu, Kyoto, Japan). Then, each fraction was separated using the UltiMate™ 3000 UHPLC system (Thermo Fisher Scientific, San Jose, CA, USA). The peptides separated from Nano HPLC were subjected to tandem mass spectrometry Q EXACTIVE HF X (Thermo Fisher Scientific, San Jose, CA, USA) for data-dependent acquisition (DDA) detection by Nano electrospray ionization. The iTRAQ data were analyzed using Mascot software (version 2.3.02, Matrix Science Inc., NEB, Ipswich, MA, USA). When the FC (fold change) of a protein is greater than 1.2 or less than 0.83, it is considered a DEP. Functional annotations of the DEPs were conducted using the Blast2GO program against the nonredundant protein database (NR, NCBI). The Kyoto Encyclopedia of Genes and Genomes (KEGG) database and the COG database (NCBI) were used to classify and group the identified proteins.

2.6. Construction of the Mutant Strains

The engineered S. cerevisiae strains with a knocked-out scFDH1 gene were constructed using the CRISPR/Cas9 method that was described in previous study [22,23]. The strains and plasmids used in the experiment were shown in Table 2. Plasmids p414-TEF1p-Cas9-CYC1t (#43802) and p426-SNR52p-gRNA.CAN1.Y-SUP4t (#43803) were obtained from Addgene Inc. The NGG locus was found, and sgRNA was created online (http://crispr.mit.edu/, accessed on 10 December 2021) based on the sequence of scFDH1. sgRNA was ligated into the gRNA scaffold of plasmid gRNA through Bfa I enzyme digestion to construct the gRNA expression vector sgRNA-gRNA.
S. cerevisiae BY4741 was employed as the host strain to inactivate the scFDH1 gene. Total genomic DNA of BY4741 was used as a template to amplify the homology arms scFDH1-UP and scFDH1-Down, with primers scFDH1-up-F/scFDH1-up-R and scFDH1-down-F/scFDH1-down-R, respectively. The PCR product purification kit (Tiangen biochemical technology (Beijing) Co., Ltd., Beijing, China) was used to purify scFDH1-UP and scFDH1-Down fragments for fusion PCR amplification to create homology arms for repair. The fused fragments were then ligated into the pMD19-T vector and transformed to Escherichia coli DH5α competent cells. Primers M13-F and M13-R (Table 2) were used for the verification of the positive colony.
Repair homologous arms (10 pmol), plasmid Cas9m (3 μg) and sgRNA-gRNA (3 μg) were electrically transformed into approximately 5 × 105 BY4741 competent cells at 1500 KV. After being cultured at 30 °C for 3 h, the yeasts were spread on a YPD plate containing G418. The deletion of the scFDH1 gene was confirmed by PCR amplification with primers scFDH1-UP-F/scFDH1-DOWN-R and scFDH1-KpnI-F/scFDH1-BamHI-R. The PCR products were purified and ligated into the pMD19-T vector and then transformed to E. coli DH5α competent cells. The Primers M13-F and M13-R (Table 2) were used for the verification of the positive colony. The yeast mutants with the scFDH1 gene knocked-out were named BY4741△scFDH1.
The FDH1 gene from Z. mellis was amplified using primers zmFDH1-KpnI-F and zmFDH1-BamHI-R. The PCR product purification kit (Tiangen biochemical technology (Beijing) Co., Ltd., Beijing, China) was used to purify the amplified zmFDH1, which was then ligated into the pYES2 plasmid through KpnI and BamHI double digestion to construct the plasmid zmFDH1-PYE2. The plasmid zmFDH1-PYE2 was transformed into E. coli DH5α competent cells and then grown on an LB plate containing ampicillin overnight at 37 °C. Primers T7 and CYC1 Terminator were used to identify positive colonies. The plasmid zmFDH1-pYES2 was transformed into the BY4741△scFDH1 cells and then spread on an SC-URA plate at 30 °C. Primers T7 and CYC1 terminator were used to confirm the positive clones. The confirmed yeast mutants, which contain the zmFDH1 gene, were named BYzm4717FDH1.

2.7. ATP and NADH Content Determination

The yeast culture solution at 24 h was centrifuged at 9000 rpm and 4 °C for 10 min. The ATP content was assayed according to the kit instructions of the ATP content assay kit (BC0300) (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China). After the extract solution was added, the yeasts were broken by an ultrasonic method for 1 min and then centrifugated at 9000 rpm and 4 °C for 10min. The supernatant was mixture with chloroform. After being centrifuged at 9000 rpm and 4 °C for 3 min, the supernatant was used for ATP content determination.
The NADH content was assayed according to the kit instructions of the NADH content assay kit (BC0310) (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China). After the alkaline extract solution was added, the yeasts were broken by an ultrasonic method for 1 min and boiled for 5 min. After being centrifuged at 9000 rpm and 4 °C for 3 min, the supernatant was added to an equal volume of acid extract solution. The mixture was centrifuged at 9000 rpm and 4 °C for 10 min, and the supernatant was used for NADH content determination.

2.8. qRT-PCR Amplification

The relative expression levels of FDH1 in BY4741, BY4741△scFDH1 and BY4717zmFDH1 were measured using qRT-PCR. Total RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA). The PCR primers for the reaction were designed using primer premier 6.0 (Table 2). PCRs were performed with primers FDH1-F/FDH1-R using the Applied Biosystems 7500 Real-Time Fast Real-time PCR System (Life Technologies, Carlsbad, CA, USA). The comparative CT method (2−∆∆CT) was used to determine the relative level of mRNA expression [24], and ACT was used as a housekeeping gene.

2.9. Data Analysis

All experiments were performed in triplicate, and the data are reported as the mean (n = 3, biologically independent replicates) ± standard error. Statistical analyses were performed by one-way analysis of variance (ANOVA) followed by Tukey test and two-way ANOVA using SPSS (IBM® SPSS® Statistics, versus 19.0), and differences of p < 0.05 were considered significant.

3. Results

3.1. Identification of Yeasts in Honey and the Influence of Sugar Stress on Yeast Growth

Yeasts were isolated from 18 honey samples (Table S2), mainly including winter honey, loquat honey and litchi honey. Among these samples, six (EH2, WH1, LQH1, LQH4, LCH5 and LCH6) had high yeast counts. DNA metabarcoding technology was used to identify the yeast community of these six samples, resulting in the identification of Z. rouxii, Z. mellis and Z. siamensis.
As shown in Figure S1, the growth of Z. rouxii, Z. mellis and Z. siamensis in 60% YPD was investigated. For Z. mellis and Z. rouxii, the biomass of the group cultured with 60% YPD had the same biomass as the controls at 56 h. For Z. siamensis, the biomass of the 60% YPD group was lower than that of the control. The controls showed a period of exponential growth before 24 h, while the 60% glucose YPD groups grew quickly between 16 and 40 h, indicating that growth is delayed in the hypertonic environment. Considering the growth rate and biomass, the yeasts that were cultured for 24 h were used for the following experiments. As a result, the contents of glycerol and trehalose in yeast under 60% glucose YPD increased, as well as the activity of the CAT, SOD and POD enzymes. The resistance of Z. mellis to high sugar stress was better than Z. siamensis, but weaker than Z. rouxii, as evidenced by the results of the growth situation, enzyme activity and glycerol and trehalose contents (Figure S1).

3.2. iTRAQ Data Analysis

The mechanism of sugar tolerance in Z. mellis was analyzed by proteomic techniques. The results showed that there were 522 DEPs in the 60% glucose YPD group compared with the 2% glucose YPD group, of which 303 (58.05%) were upregulated and 219 (41.95%) were downregulated (Table S3). Detailed information about the DEPs, including protein sequences and the values of SD, are listed in Table S4. According to the KOG functional categories, DEPs were classified into 23 groups. Among them, most DEPs were related to post-translational modification, protein turnover and chaperones (16.19%), amino acid transport and metabolism (15.19%), and energy production and conversion (14.85%). Additionally, formate dehydrogenase1 (FDH1), which catalyzes the decomposition of formic acid to produce CO2 and the reduction of NAD+ to NADH, showed a great increase in response to high sugar stress [15]. The DEPs involved in the metabolic pathway of trehalose, glycerol and the TCA cycle, etc., are listed in Table 3. Among them, the proteins related to trehalose and glycerol degradation were all downregulated, and most of the proteins related to the glycolysis and pentose phosphate pathways were also downregulated. In contrast, most proteins related to TCA and respiration were upregulated.

3.3. Construction of the Mutant Strains Y4741△scFDH1 and BYzm4717FDH1

The process of constructing S. cerevisiae BY4741 strains with different FDH1 statuses is shown in Figure 1. The sgRNA sequence that was designed based on the sequence of the scFDH1 gene was 5’–GTTACACAGAGCTTCAGGTT–3’. The expression vector was then constructed by ligating sgRNA into the gRNA scaffold of gRNA. Because scFDH1 was knocked out, PCR amplification with the primers FDH1-Up-F and FDH1-Down-R yielded a PCR product of 2091 bp (Figure 1C2); however, PCR amplification with the primers FDH1-KpnI-F and FDH1-BamHI-R yielded no corresponding band (Figure 1C3). The positive clones were screened and named BY4741△scFDH1.
The FDH1 gene was amplified from Z. mellis and ligated into the plasmid pYES2, and the product was transformed into the BY4741△scFDH1 strain. A 1068 bp band was observed through PCR amplification with the primers zmFDH1-KpnI-F and zmFDH1-BamHI-R, indicating that the yeast strain BYzmFDH1 containing the zmFDH1 gene had been obtained (Figure 1C).

3.4. Effect of Sugar Stress on the Growth of BY4741△scFDH1 and BYzm4717FDH1

The OD values of BY4741, BY4741△scFDH1 and BYzm4717FDH1, which were grown in 20% and 60% glucose YPD for 3 d, respectively, were determined every 6 h (Figure 2A). The results revealed that there was no significant difference among these three strains in 20% glucose YPD at 24 h. The OD value of BY4741△scFDH1 was significantly reduced compared with BY4741 in 60% glucose YPD (p < 0.01) at 24 h, while BYmzFDH1 resumed its regular growth pattern, showing no difference from BY4741.
As shown in Figure 2B,C, the intracellular glycerol and trehalose contents in yeasts under high sugar stress were measured. Our results showed that glycerol and trehalose in Z. mellis accumulated in yeasts significantly during fermentation with 60% glucose YPD (Supplementary Figure S1). In comparison to BY4741, the amount of intracellular glycerol, as well as the activity of SOD, CAT and POD, decreased in BY4741△scFDH1, but the amount of intracellular glycerol and trehalose, as well as POD activity, increased in BYzm4717FDH1.
As shown in Figure 3, the relative expression of FDH1 and the contents of ATP and NADH in yeasts were measured. The FDH1 gene was almost not expressed in BY4741△scFDH1 but was expressed normally in BYzm4717FDH1, indicating that FDH1 was successfully knocked out in BY4741△scFDH1 and expressed in BYzm4717FDH1. Compared with BY4741, the ATP and NADH contents decreased in BY4741△scFDH1, but there was no difference in BYzm4717FDH1, indicating that FDH1 has a significant effect on ATP and NADH synthesis.

4. Discussion

Honey contains a large number of nutrients, including protein, amino acids, enzymes, minerals, vitamins and aromatic compounds except sugar. Honey also has antioxidant and antibacterial activity, which can be used for anti-aging and burn treatments [25]. In addition, honey is also a natural food to make wine using yeast. A few studies have shown that mixed yeast strains show better fermentation characteristics, such as increasing glycerol content and total acidity and producing a variety of volatile phenols, esters, ketones and other special substances [26]. In this study, Z. mellis that was isolated from honey showed high hypertonic tolerance in response to high sugar stress with the potential for food fermentation.
Hyperosmotic stress stimulates a large variety of adaptive responses in yeast cells that affect many different physiological functions to adapt to the environment. During the fermentation process, because high concentrations of sugar and accumulated ethanol have toxic effects on yeast cells, yeasts have a series of physiological regulatory mechanisms to resist high osmotic stress, leading to growth delays [27,28,29]. Previous studies have shown that yeast can produce and retain metabolically compatible osmolytes, including intracellular glycerol and trehalose, to adapt to the hyperosmotic environment [30,31,32]. Transcriptomics analysis revealed that some genes involved in the pathway of the high osmolarity glycerol mitogen-activated protein kinase (HOG-MAPK) signal transduction and trehalose synthesis, as well as the oxidative stress response, were upregulated under high-glucose tolerance in Z. mellis [6]. In addition, the morphological and structural properties of the cell wall and plasma membrane can also be regulated [33].
In this study, proteome analysis revealed that the proteins involved in the regulation of cell-wall, membrane and envelope biogenesis were all downregulated. Among them, Chitin cross-links with β-glucan to form a cell-wall skeleton and plays a key role in maintaining cell morphology and structure [34,35]. Ergosterol, an important component of the microbial cell membrane, can stabilize the membrane structure by combining with phospholipids to regulate membrane permeability, membrane fluidity, integrity and cell material transport [36]. Under alcohol treatment, the content of ergosterol in the cell membrane of S. cerevisiae can increase to inhibit membrane damage and maintain normal membrane permeability [36,37,38]. However, in this study, due to the growth delay, the proteins involved in cell-wall and ergosterol synthesis were downregulated.
Intracellular glycerol and trehalose, which can be used as osmotic protectants, will accumulate in yeast cells in response to external osmotic stress. It was reported that trehalose and glycerol can protect the cell membranes in response to sugar, NaCl and metal ions [7,39,40]. iTRAQ data revealed that the proteins involved in the degradation of glycerol and trehalose were downregulated in the assayed yeast. Among them, glycerol kinase, dihydroxyacetone kinase 1 and glycerol-3-phosphate/dihydroxyacetone phosphate acyltransferase (38) are involved in the degradation of glycerol [41,42,43], and phosphoglucomutase-2 is involved in the degradation of trehalose [40]. In yeasts, there are two well-established pathways to produce glycerol, including the Gcy-Dak pathway and the Gpd-Gpp pathway [7]. The proteins related to glycerol generation, including TPS and otsB, had been identified in response to high sugar stress in Z. mellis [6], but in this study, no proteins involved in these biosynthetic pathways were significantly differentially expressed. These results indicated that glycerol and trehalose also accumulated via decreased degradation, which is consistent with previous studies showing that glycerol accumulated under high osmotic pressure by retention [44]. As a result, this study revealed that osmotic protectants accumulated rapidly in the early stages of high-sugar fermentation to resist external hypertonic pressure in Z. mellis.
Many studies have shown that antioxidant enzymes, such as SOD, CAT and POD, can play an important role against reactive oxygen species (ROS) to protect organisms from oxidative damage [45,46,47]. When yeast is under stress, the intracellular ROS content will rapidly increase, and the enzyme activities and the expression level of the encoding genes will be upregulated to regulate the intracellular ROS balance [32,48]. SOD catalyzes two molecules of superoxide anion (O2−) to generate hydrogen peroxide (H2O2) and oxygen (O2), and CAT and POD then decompose H2O2 into H2O and O2 [49]. The improved antioxidant enzyme activities could enhance the high salt tolerance of Z. rouxii [32]. In addition, the expression level of SOD was upregulated, which was consistent with the result of transcriptomics analysis [6]. In S. cerevisiae, SOD could protect RNR from inactivation, and sod1Δ and sod2Δ mutants showed decreased growth under aerobic conditions [50]. In this study, the enzyme activities and protein expression of SOD, CAT and POD were increased during fermentation to eliminate the damaging effect of H2O2 on cells and avoid oxidative damage in a high-sugar environment.
Osmotic stress can increase the activities of MDH and SDH, which are the key enzymes of glucose metabolism and the TCA cycle and are involved in energy metabolism processes and respiration [51]. In fungi, the inhibition of enzyme activities involved in energy metabolism and respiration, especially SDH and MDH, resulted in the inhibition of mycelial growth [52]. Mitochondrial defects lead to the hyperaccumulation of ROS in response to salt stress [53].
In the proteome experiment, 45 proteins were identified that are related to energy metabolism, 29 of which were upregulated, while the other 16 were downregulated (Table S4). Among them, cytochrome c oxidase is the terminal enzyme of the mitochondrial membrane respiratory chain, and its function is directly related to ATP synthesis and associated with programmed cell death in yeast [54]. In addition, 7 of 10 proteins involved in the TCA cycle were upregulated (Table 2). Among these proteins, the expression levels of the SDH and MDH proteins were upregulated, which was consistent with the observed changes in enzyme activity. It has been shown that the expression of energy-related genes, especially those related to respiration and energy metabolism, increases with the duration of hyperosmolar stress in S. cerevisiae [55]. Upregulation of proteins in the respiratory chain and the TCA cycle can produce more ATP, providing energy for cells to adapt to hypertonic environments.
The protein with the greatest difference in expression was FDH1, which can oxidize formic acid to CO2 and reduce NAD+ to NADH; it has been used in studies of coenzyme regeneration [19,56] and was upregulated under stress conditions [57,58]. NADH enters the electron transport chain through the glycerophosphate shuttle and malate aspartate acid shuttle, and acts as a respiratory substrate for ATP generation through oxidative phosphorylation. The overexpression of the FDH gene could increase the content of NADH and lead to a significant increase in intracellular ATP [59,60]. The increase in ATP had a significant inhibitory effect on the glycolysis pathway [61], and the proteome data also demonstrated a decrease in the expression of proteins involved in the glycolysis pathway. In this study, the knockout of the FDH1 gene in S. cerevisiae slowed growth, lowered ATP, NADH, trehalose and glycerol contents, and decreased the enzyme activities of CAT, SOD and POD. However, the expression of the zmFDH1 gene in the BY4741scFDH1 strain resulted in the resumption of growth, an increase in trehalose and glycerol contents, and an increase in the activity of the CAT, SOD and POD enzymes, suggesting that the FDH1 gene may impact yeast hypertonic tolerance.

5. Conclusions

In this study, DNA metabarcoding technology was used to identify yeast species in honey. As a result, Z. rouxii, Z. mellis and Z. siamensis were identified. In the presence of a high sugar content (60%, w/v), yeast growth was delayed. In order to adapt to the hyperosmotic environment, Z. mellis increased the content of trehalose and glycerin and enhanced energy metabolism before other physiological adjustments. iTRAQ data showed that most of the proteins associated with cell growth, including the cell membrane, cell-wall synthesis and glycolysis and pentose phosphate pathways, etc., were downregulated in Z. mellis. Moreover, CRISPR/Cas9 technology constructed an FDH1-inactivated yeast, demonstrating that the FDH1 gene has a significant effect on the yeast’s hypertonic tolerance.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/pr10061193/s1, Figure S1. The influence of sugar stress on the growth of Z. mellis, Z. rouxii and Z. siamensis. Table S1. Honey samples from different botanical and geographical origins. Table S2. Number of isolated yeasts from honey samples. Table S3. DEPs of Z. mellis in response to sugar stress. Table S4. DEPs annotation.

Author Contributions

X.X. conceived and designed this research, analyzed the data and wrote the paper; Y.Z., Y.L., X.C. and H.Z. performed experiments and analyzed the data; Y.Z., W.Y. and X.X. designed the experiments and edited the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by “The Natural Science Foundation of the Fujian Province, No.2020J01131023” (Fujian Provincial Department of Science and Technology).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available in Table 3, Supplementary Tables S1–S4.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Mateo, R.; Bosch-Reig, F. Sugar profiles of Spanish unifloral honeys. Food Chem. 1997, 60, 33–41. [Google Scholar] [CrossRef]
  2. Rawsthorne, H.; Phister, T.G. A real-time PCR assay for the enumeration and detection of Zygosaccharomyces bailii from wine and fruit juices. Int. J. Food Microbiol. 2006, 112, 1–7. [Google Scholar] [CrossRef] [PubMed]
  3. Carvalho, C.M.; Meirinho, S.; Estevinho, M.L.F.; Choupina, A. Yeast species associated with honey: Different identification methods. Arch. Zootec. 2010, 59, 103–113. [Google Scholar] [CrossRef] [Green Version]
  4. Liu, G.; Tao, C.; Zhu, B.; Bai, W.; Zhang, L.; Wang, Z.; Liang, X. Identification of Zygosaccharomyces mellis strains in stored honey and their stress tolerance. Food Sci. Biotechnol. 2016, 25, 1645–1650. [Google Scholar] [CrossRef] [PubMed]
  5. Wrent, P.; Rivas, E.M.; Peinado, J.M.; de Silóniz, M.I. Strain typing of Zygosaccharomyces yeast species using a single molecular method based on polymorphism of the intergenic spacer region (IGS). Int. J. Food Microbiol. 2010, 142, 89–96. [Google Scholar] [CrossRef] [Green Version]
  6. Liu, G.; Bi, X.; Tao, C.; Fei, Y.; Gao, S.; Liang, J.; Bai, W. Comparative transcriptomics analysis of Zygosaccharomyces mellis under high-glucose stress. Food Sci. Hum. Wellness 2021, 10, 54–62. [Google Scholar] [CrossRef]
  7. Dakal, T.C.; Solieri, L.; Giudici, P. Adaptive response and tolerance to sugar and salt stress in the food yeast Zygosaccharomyces rouxii. Int. J. Food Microbiol. 2014, 185, 140–157. [Google Scholar] [CrossRef]
  8. Giardina, B.J.; Stanley, B.A.; Chiang, H.L. Comparative proteomic analysis of transition of Saccharomyces cerevisiae from glucose-deficient medium to glucose-rich medium. Proteome Sci. 2012, 10, 40. [Google Scholar] [CrossRef] [Green Version]
  9. Estéfani, G.R.; Amparo, Q.; José Manuel, G. iTRAQ-based proteome profiling of saccharomyces cerevisiae and cryotolerant species S. uvarum and S. kudriavzevii during low-temperature wine fermentation. J. Proteomics. 2016, 146, 70–79. [Google Scholar] [CrossRef]
  10. Saini, P.; Beniwal, A.; Kokkiligadda, A.; Vij, S. Response and tolerance of yeast to changing environmental stress during ethanol fermentation. Process Biochem. 2018, 72, 1–12. [Google Scholar] [CrossRef]
  11. Li, C.; Xu, Y.; Jiang, W.; Lv, X.; Dong, X. Effect of sodium chloride and cadmium on the growth, oxidative stress and antioxidant enzyme activities of Zygosaccharomyces rouxii. J. Ocean Univ. China 2014, 13, 460–466. [Google Scholar] [CrossRef]
  12. Saito, H.; Tatebayashi, K. Regulation of the osmoregulatory HOG MAPK cascade in yeast. J. Biochem. 2004, 136, 267–272. [Google Scholar] [CrossRef]
  13. Babazadeh, R.; Furukawa, T.; Hohmann, S.; Furukawa, K. Rewiring yeast osmostress signalling through the MAPK network reveals essential and non-essential roles of Hog1 in osmoadaptation. Sci. Rep. 2014, 4, 1–7. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Guo, H.; Niu, C.; Liu, B.; Wei, J.P.; Wang, H.X.; Yuan, Y.H.; Yue, T.L. Protein abundance changes of Zygosaccharomyces rouxii in different sugar concentrations. Int. J. Food Microbiol. 2016, 233, 44–51. [Google Scholar] [CrossRef] [PubMed]
  15. Noti, O.; Vaudano, E.; Giuffrida, M.G.; Lamberti, C.; Cavallarin, L.; Garcia-Moruno, E.; Pessione, E. Enhanced arginine biosynthesis and lower proteolytic profile as indicators of, Saccharomyces cerevisiae, stress in stationary phase during fermentation of high sugar grape must: A proteomic evidence. Food Res. Int. 2018, 105, 1011–1018. [Google Scholar] [CrossRef] [PubMed]
  16. Tedersoo, L.; Anslan, S.; Bahram, M.; Põlme, S.; Riit, T.; Liiv, I.; Kõljalg, U.; Kisand, V.; Nilsson, R.H.; Hildebrand, F.; et al. Shotgun metagenomes and multiple primer pair-barcode combinations of amplicons reveal biases in metabarcoding analyses of fungi. MycoKeys 2015, 10, 1–43. [Google Scholar] [CrossRef]
  17. Blaalid, R.; Kumar, S.; Nilsson, R.H.; Abarenkov, K.; Kirk, P.M.; Kauserud, H. ITS1 versus ITS2 as DNA metabarcodes for fungi. Mol. Mol. Ecol. Res. 2013, 13, 218–224. [Google Scholar] [CrossRef] [Green Version]
  18. Pompanon, F.; Coissac, E.; Taberlet, P. Metabarcoding, a new way of analysing biodiversity. Biofutur 2011, 319, 30–32. [Google Scholar]
  19. Magoč, T.; Salzberg, S.L. FLASH: Fast length adjustment of short reads to improve genome assemblies. Bioinformatics 2011, 27, 2957–2963. [Google Scholar] [CrossRef]
  20. Bondioli, P.; Della, B.L. An alternative spectrophotometric method for the determination of free glycerol in biodiesel. Eur. J. Lipid Sci. Technol. 2005, 107, 153–157. [Google Scholar] [CrossRef]
  21. Wang, X.H.; Zhang, Y.Y.; Wang, C.; Wang, C.L.; Hou, L. Intracellular level of trehalose in soy sauce yeasts under different stresses. IERI Procedia 2013, 5, 321–326. [Google Scholar] [CrossRef] [Green Version]
  22. DiCarlo, J.E.; Norville, J.E.; Mali, P.; Rios, X.; Aach, J.; Church, G.M. Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res. 2013, 41, 4336–4343. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Stovicek, V.; Borodina, I.; Forster, J. CRISPR-Cas system enables fast and simple genome editing of industrial Saccharomyces cerevisiae strains. Metab. Eng. Commun. 2015, 2, 13–22. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data using Real-Time Quantitative PCR. Methods 2002, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  25. Stagos, D.; Soulitsiotis, N.; Tsadila, C.; Papaeconomou, S.; Arvanitis, C.; Ntontos, A.; Karkanta, F.; Adamou-Androulaki, S.; Petrotos, K.; Spandidos, D.A.; et al. Antibacterial and antioxidant activity of different types of honey derivedfrom Mount Olympus in Greece. Int. J. Mol. 2018, 42, 726–734. [Google Scholar] [CrossRef] [Green Version]
  26. Multari, S.; Guzzon, R.; Caruso, M.; Licciardello, C.; Martens, S. Alcoholic fermentation of citrus flavedo and albedo with pure and mixed yeast strains: Physicochemical characteristics and phytochemical profiles. LWT 2021, 144, 111133. [Google Scholar] [CrossRef]
  27. Benjaphokee, S.; Hasegawa, D.; Yokota, D.; Asvarak, T.; Auesukaree, C.; Sugiyama, M.; Kaneko, Y.; Boonchird, C.; Harashima, S. Highly efficient bioethanol production by a saccharomyces cerevisiae strain with multiple stress tolerance to high temperature, acid and ethanol. New Biotechnol. 2012, 29, 379–386. [Google Scholar] [CrossRef]
  28. Matallana, E.; Aranda, A. Biotechnological impact of stress response on wine yeast. Lett. Appl. Microbiol. 2017, 64, 103–110. [Google Scholar] [CrossRef] [Green Version]
  29. Auesukaree, C. Molecular mechanisms of the yeast adaptive response and tolerance to stresses encountered during ethanol fermentation. J. Biosci. Bioeng. 2017, 124, 133–142. [Google Scholar] [CrossRef]
  30. Noti, O.; Vaudano, E.; Pessione, E.; Garcia-Moruno, E. Short-term response of different Saccharomyces cerevisiae strains to hyperosmotic stress caused by inoculation in grape must: RT-qPCR study and metabolite analysis. Food Microbiol. 2015, 52, 49–58. [Google Scholar] [CrossRef] [Green Version]
  31. Petelenz-Kurdziel, E.; Kuehn, C.; Nordlander, B.; Klein, D.; Klipp, E. Quantitative analysis of glycerol accumulation, glycolysis and growth under osmotic stress. PLoS Comput. Biol. 2013, 9, e1003084. [Google Scholar] [CrossRef] [PubMed]
  32. Li, L.L.; Ye, Y.R.; Pan, L.; Zhu, Y.; Zheng, S.P.; Lin, Y. The induction of trehalose and glycerol in Saccharomyces cerevisiae in response to various stresses. Biochem. Biophys. Res. Commun. 2009, 387, 778–783. [Google Scholar] [CrossRef] [PubMed]
  33. Willaert, R.G. The growth behavior of the model eukaryotic yeast Saccharomyces cerevisiae in microgravity. Curr. Biotechnol. 2013, 2, 226–234. [Google Scholar] [CrossRef]
  34. Hartland, R.P.; Vermeulen, C.A.; Sietsma, J.H.; Wessels, J.G.H.; Klis, F.M. The linkage of (1–3)-β-glucan to chitin during cell wall assembly in Saccharomyces cerevisiae. Yeast 1994, 10, 1591–1599. [Google Scholar] [CrossRef] [Green Version]
  35. Grün, C.H.; Hochstenbach, F.; Humbel, B.M.; Verkleij, A.J.; Sietsma, J.H.; Klis, F.M.; Kamerling, J.P.; Vliegenthart, J.F.G. The structure of cell wall α-glucan from fission yeast. Glycobiology 2005, 15, 245–257. [Google Scholar] [CrossRef] [Green Version]
  36. Vanegas, J.M.; Contreras, M.F.; Faller, R.; Longo, M.L. Role of unsaturated lipid and ergosterol in ethanol tolerance of model yeast biomembranes. Biophys. J. 2012, 102, 507–516. [Google Scholar] [CrossRef] [Green Version]
  37. Shobayashi, M.; Mitsueda, S.I.; Ago, M.; Fujii, T.; Iwashita, K.; Iefuji, H. Effects of culture conditions on ergosterol biosynthesis by Saccharomyces cerevisiae. Biosci. Biotechnol. Biochem. 2005, 69, 2381–2388. [Google Scholar] [CrossRef] [Green Version]
  38. Henderson, C.M.; Block, D.E. Examining the role of membrane lipid composition in determining the ethanol tolerance of Saccharomyces cerevisiae. Appl. Environ. Microbiol. 2014, 80, 2966–2972. [Google Scholar] [CrossRef] [Green Version]
  39. Mahmud, S.A.; Nagahisa, K.; Hirasawa, T.; Yoshikawa, K.; Ashitani, K.; Shimizu, H. Effect of trehalose accumulation on response to saline stress in Saccharomyces cerevisiae. Yeast 2009, 26, 17–30. [Google Scholar] [CrossRef] [Green Version]
  40. Yoshiyama, Y.; Tanaka, K.; Yoshiyama, K.; Hibi, M.; Ogawa, J.; Shima, J. Trehalose accumulation enhances tolerance of Saccharomyces cerevisiae to acetic acid. J. Biosci. Bioeng. 2015, 119, 172–175. [Google Scholar] [CrossRef]
  41. Terrazas, W.D.M.; Aizemberg, R.; Gattas, E.A.D.L. Using Pichia pastoris to produce recombinant glycerol kinase. Rev. Cienc. Farm. Basica Apl. 2014, 35, 279–284. [Google Scholar]
  42. Wang, Z.X.; Kayingo, G.; Blomberg, A.; Prior, B.A. Cloning, sequencing and characterization of a gene encoding dihydroxyacetone kinase from Zygosaccharomyces rouxii NRRL2547. Yeast 2002, 19, 1447–1458. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  43. Zufferey, R.; Mamoun, C.B. The initial step of glycerolipid metabolism in Leishmania major promastigotes involves a single glycerol-3-phosphate acyltransferase enzyme important for the synthesis of triacylglycerol but not essential for virulence. Mol. Microbiol. 2005, 56, 800–810. [Google Scholar] [CrossRef] [PubMed]
  44. Myers, D.K.; Lawlor, D.T.; Attfield, P.V. Influence of invertase activity and glycerol synthesis and retention on fermentation of media with a high sugar concentration by Saccharomyces cerevisiae. Appl. Environ. Microbiol. 1997, 63, 145–150. [Google Scholar] [CrossRef] [Green Version]
  45. Chen, G.Q.; Ren, L.; Zhang, J.; Reed, B.M.; Zhang, D.; Shen, X.H. Cryopreservation affects ROS-induced oxidative stress and antioxidant response in Arabidopsis seedlings. Cryobiology 2015, 70, 38–47. [Google Scholar] [CrossRef]
  46. Anjum, S.A.; Tanveer, M.; Hussain, S.; Shahzad, B.; Ashraf, U.; Fahad, S.; Tung, S.A. Osmoregulation and antioxidant production in maize under combined cadmium and arsenic stress. Environ. Sci. Pollut. Res. 2016, 23, 11864–11875. [Google Scholar] [CrossRef]
  47. Ferrareze, J.P.; Fugate, K.K.; Bolton, M.D.; Deckard, E.L.; Campbell, L.G.; Finger, F.L. Jasmonic acid does not increase oxidative defense mechanisms or common defense-related enzymes in postharvest sugarbeet roots. Postharvest Biol. Technol. 2013, 77, 11–18. [Google Scholar] [CrossRef]
  48. Lu, F.P.; Wang, Y.; Bai, D.Q.; Du, L.X. Adaptive response of Saccharomyces cerevisiae to hyperosmotic and oxidative stress. Process Biochem. 2005, 40, 3614–3618. [Google Scholar] [CrossRef]
  49. Sahu, S.; Das, P.; Ray, M.; Sabat, S.C. Osmolyte modulated enhanced rice leaf catalase activity under salt-stress. Adv. Biosci. Biotechnol. 2010, 1, 39–46. [Google Scholar] [CrossRef] [Green Version]
  50. Das, A.B.; Sadowska-Bartosz, I.; Königstorfer, A.; Kettle, A.J.; Winterbourn, C.C. Superoxide dismutase protects ribonucleotide reductase from inactivation in yeast. Free Radic. Biol. Med. 2018, 116, 114–122. [Google Scholar] [CrossRef]
  51. Baroowa, B.; Gogoi, N. The effect of osmotic stress on anti-oxidative capacity of black gram (Vigna Mungo L.). Exp. Agric. 2017, 53, 84–99. [Google Scholar] [CrossRef] [Green Version]
  52. Haghdoost, N.S.; Salehi, T.Z.; Khosravi, A.; Sharifzadeh, A. Antifungal activity and influence of propolis against germ tube formation as a critical virulence attribute by clinical isolates of Candida albicans. J. Mycol Med. 2016, 26, 298–305. [Google Scholar] [CrossRef] [PubMed]
  53. Ludovico, P.; Rodrigues, F.; Almeida, A.; Silva, M.T.; Barrientos, A.; Côrte-Real, M. Cytochrome c release and mitochondria involvement in programmed cell death induced by acetic acid in Saccharomyces cerevisiae. Mol. Biol. Cell. 2002, 13, 2598–2606. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  54. Yale, J.; Bohnert, H.J. Transcript expression in Saccharomyces cerevisiae, at high salinity. J. Biol. Chem. 2001, 276, 15996–16007. [Google Scholar] [CrossRef] [Green Version]
  55. Tishkov, V.I.; Popov, V.O. Protein engineering of formate dehydrogenase. Biomol. Eng. 2006, 23, 89–110. [Google Scholar] [CrossRef]
  56. Suzuki, K.; Itai, R.; Suzuki, K.; Nakanishi, H.; Nishizawa, N.K.; Yoshimura, E.; Mori, Y.S. Formate dehydrogenase, an enzyme of anaerobic metabolism, is induced by iron deficiency in barley roots. Plant Physiol. 1998, 116, 725–732. [Google Scholar] [CrossRef] [Green Version]
  57. Hourton-Cabassa, C.; Ambard-Bretteville, F.; Moreau, F.; Davy de Virville, J.; Rémy, R.; Francs-Small, C.C. Stress Induction of Mitochondrial Formate Dehydrogenase in Potato Leaves. Plant Physiol. 1998, 116, 627–635. [Google Scholar] [CrossRef] [Green Version]
  58. Chen, Y.; Cai, R. Study and analytical application of inhibitory effect of captopril on multienzyme redox system. Talanta 2003, 61, 855–861. [Google Scholar] [CrossRef]
  59. Berríos-Rivera, S.J.; Bennett, G.N.; San, K.Y. Metabolic engineering of Escherichia coli: Increase of NADH availability by overexpressing an NAD(+)-dependent formate dehydrogenase. Metab. Eng. 2002, 4, 217–229. [Google Scholar] [CrossRef] [Green Version]
  60. Du, C.; Li, Y.; Xiang, R.; Yuan, W. Formate dehydrogenase improves the resistance to formic acid and acetic acid simultaneously in Saccharomyces cerevisiae. Int. J. Mol. Sci. 2022, 23, 3406. [Google Scholar] [CrossRef]
  61. Liu, L.M.; Li, Y.; Shi, Z.P.; Du, G.C.; Chen, J. Enhancement of pyruvate productivity in torulopsis glabrata: Increase of NAD+ availability. J. Biotechnol. 2006, 126, 173–185. [Google Scholar] [CrossRef] [PubMed]
Processes 10 01193 g001 550
Figure 1. Strain construction. (A): Schematic of construction of BY4741△scFDH1 and BY4717mzFDH1 strains. (B): PCR amplification. (1) Product of the homology arms; M: maker; down: down repair homologous arm; up: up repair homologous arm. (2) Confirmation of BY4741△scFDH1 strain by PCR using primers FDH1-Up-F and FDH1-Down-R; M: marker; 1: negative colony; 2: positive colony. (3) Confirmation of BY4741△scFDH1 strain by PCR using primers FDH1-KpnI-F and H1-BamHI-R. (4) PCR result of BYmzFDH1 strain; M: marker; 1: negative colony; 2: positive colony. (C): Colonies of BY4741, BY4741△scFDH1 and BYmzFDH1 strains; M: marker; 1: negative colony. (D): The sites of the primers.
Figure 1. Strain construction. (A): Schematic of construction of BY4741△scFDH1 and BY4717mzFDH1 strains. (B): PCR amplification. (1) Product of the homology arms; M: maker; down: down repair homologous arm; up: up repair homologous arm. (2) Confirmation of BY4741△scFDH1 strain by PCR using primers FDH1-Up-F and FDH1-Down-R; M: marker; 1: negative colony; 2: positive colony. (3) Confirmation of BY4741△scFDH1 strain by PCR using primers FDH1-KpnI-F and H1-BamHI-R. (4) PCR result of BYmzFDH1 strain; M: marker; 1: negative colony; 2: positive colony. (C): Colonies of BY4741, BY4741△scFDH1 and BYmzFDH1 strains; M: marker; 1: negative colony. (D): The sites of the primers.
Processes 10 01193 g001
Processes 10 01193 g002 550
Figure 2. The influence of sugar stress on the growth of BY4741, BY4741△scFDH1 and BY4717zmFDH1. (A): The OD600 values of BY4741, BY4741△scFDH1 and BY4717zmFDH1. (B): The intracellular glycerol and trehalose contents of BY4741, BY4741△scFDH1 and BY4717zmFDH1 under 60% YPD. (C): The enzyme activities of CAT, SOD and POD of BY4741, BY4741△scFDH1 and BY4717zmFDH1 under 60% YPD. (A): Two-way analysis of variance (ANOVA); (B,C): one-way analysis of variance (ANOVA) followed by Tukey test. * represents significant difference, p value < 0.05, ** represents extremely significant difference between treatment and control, p value < 0.01, and *** represents extremely significant difference between treatment and control, p value < 0.001.
Figure 2. The influence of sugar stress on the growth of BY4741, BY4741△scFDH1 and BY4717zmFDH1. (A): The OD600 values of BY4741, BY4741△scFDH1 and BY4717zmFDH1. (B): The intracellular glycerol and trehalose contents of BY4741, BY4741△scFDH1 and BY4717zmFDH1 under 60% YPD. (C): The enzyme activities of CAT, SOD and POD of BY4741, BY4741△scFDH1 and BY4717zmFDH1 under 60% YPD. (A): Two-way analysis of variance (ANOVA); (B,C): one-way analysis of variance (ANOVA) followed by Tukey test. * represents significant difference, p value < 0.05, ** represents extremely significant difference between treatment and control, p value < 0.01, and *** represents extremely significant difference between treatment and control, p value < 0.001.
Processes 10 01193 g002
Processes 10 01193 g003 550
Figure 3. The influence of sugar stress on the relative expression of FDH1gene (A), ATP content (B) and NADH content (C) of BY4741, BY4741△scFDH1 and BY4717zmFDH1. a: BY4741, b: BY4741△scFDH1, c: BY4717zmFDH1 (one-way analysis of variance (ANOVA) followed by Tukey test). * represents significant difference, p value < 0.05, and ** represents extremely significant difference between treatment and control, p value < 0.01.
Figure 3. The influence of sugar stress on the relative expression of FDH1gene (A), ATP content (B) and NADH content (C) of BY4741, BY4741△scFDH1 and BY4717zmFDH1. a: BY4741, b: BY4741△scFDH1, c: BY4717zmFDH1 (one-way analysis of variance (ANOVA) followed by Tukey test). * represents significant difference, p value < 0.05, and ** represents extremely significant difference between treatment and control, p value < 0.01.
Processes 10 01193 g003
Table
Table 1. Primers used in this study.
Table 1. Primers used in this study.
NameSequences 5’ to 3’
ITS1TCCGTAGGTGAACCTGCGG
ITS2GCTGCGTTCTTCATCGATGC
FDH1-UP-FATAGGCTTGAAAGAGAGTTTTAA
FDH1-UP-RAATACTCATAATCACTCATTAATTTTCAGCTGTTATTTTG
FDH1-down-FATAACAGCTGAAAATTAATGAGTGATTATGAGTATTTGTGAGCA
FDH1-down-RTTTTCTGCAGCAGATACTTTTGG
scFDH1-KpnI-FGGGGTACCAACACAATGTCGAAGGGAAAGGTTTTGC
scFDH1-BamHI-RCGGGATCCTTATTTCTTCTGTCCATAAGCTC
zmFDH1-KpnI-FGGGGTACCAACACAATGTGCAAGGGCAAGGTGTC
zmFDH1-BamHI-RCGGGATCCATGGTCAGAAAACAAACTAG
M13-FCCCAGTCACGACGTTGTAAAACG
M13-RAGCGGATAACAATTTCACACAGG
T7TAATACGACTCACTATAGGG
CYC1 TerminatorGTGACATAACTAATTACATGATG
FDH1-FTTGCTGGCCTCGTTCAATCT
FDH1-RCCGGCGTGGCTAAAAATGAG
Table
Table 2. Strains and plasmids used throughout the study.
Table 2. Strains and plasmids used throughout the study.
NameRelevant DescriptionReferences
Strains
BY4741S288C-derivative laboratory strain, MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ016
E. coli DH5 αF-, φ80, lacZΔM15, Δ(lacZYA-argF) U169 endA1, recA1, hsdR17(rk-, mk+) supE44, λ-, thi-1, gyrA96, relA1, phoATakara Bio, Kyoto, Japan
BY4741△FDH1Saccharomyces cerevisiae BY4741, △FDH1This study
BYzm4741FDH1BY4741△FDH1, zmFDH1This study
plasmid
Cas9p414-TEF1p-Cas9-CYC1t, CEN6/ARSH4 origin, TRP1, TEF1p promoter, codon optimized Cas9 with C-terminal SV40 tag, AmpRAddgene
gRNAp426-SNR52p-gRNA.CAN1.Y-SUP4t, PSNR52-gRNA-SUP4TTAddgene
sgRNA-gRNALigation sgRNA into the gRNA scaffold of plasmid gRNAThis study
ZmFDH1-PYES2Ligation zmFDH1 into the plasmid PYES2This study
Table
Table 3. Partial DEPs of Z. mellis in response to sugar stress.
Table 3. Partial DEPs of Z. mellis in response to sugar stress.
Protein_IDDescription60% Glucose Group vs. 2% Glucose Group
TCA cycle
GCE97816.1NAD-dependent isocitrate dehydrogenase1.33
GCF00601.1phosphoglycerate kinase0.74
GCE97119.1cytochrome b subunit of succinate dehydrogenase, Sdh3p1.25
GCE99324.1NADP-dependent isocitrate dehydrogenase0.44
GCF01027.1malate dehydrogenase, cytoplasmic1.25
GCE98908.12-oxoglutarate dehydrogenase complex E2 component1.28
GCE99351.1citrate (Si)-synthase1.29
GCF00374.1succinate dehydrogenase complex, subunit B1.58
GCE97219.1succinate dehydrogenase assembly factor 20.79
GCF01476.1membrane anchor subunit of succinate dehydrogenase, Sdh41.48
Glycolysis
GCF00125.1glucokinase0.58
GCF00259.1hexokinase A0.64
GCE99269.1fructose-bisphosphate aldolase 10.69
GCE98585.1glyceraldehyde-3-phosphate dehydrogenase1.33
GCE97503.1glyceraldehyde-3-phosphate dehydrogenase 11.21
Pentose phosphate pathway
GCF00070.1enolase-phosphatase E10.55
GCE97493.1ribulose-phosphate 3-epimerase0.67
GCF01076.1sedoheptulose-7-phosphate: D-glyceraldehyde-3-phosphate transaldolase0.69
GCF01082.1glucose-6-phosphate isomerase0.78
GCE98569.1triosephosphate isomerase0.8
GCF01275.1glucose-6-phosphate 1-dehydrogenase1.25
GCF00672.1ribose-5-phosphate isomerase rki11.55
Respiratory chain
GCF00431.1ubiquinol-cytochrome c reductase core subunit 10 qcr101.4
GCE98211.1NADH: ubiquinone oxidoreductase0.48
GCF01526.1cytochrome c oxidase subunit 60.81
GCE97076.1cytochrome c oxidase subunit 41.26
GCF00071.1iso-1-cytochrome c1.29
GCF01652.1cytochrome c oxidase subunit 21.3
GCE99676.1Cu-binding protein1.31
Trehalose and glycerol degradation
GCE99412.1phosphoglucomutase-20.62
GCF00370.1glycerol kinase0.79
GCE99841.1glycerol-3-phosphate/dihydroxyacetone phosphate acyltransferase0.83
GCE98648.1dihydroxyacetone kinase 10.72
Antioxidant
GCE98999.1superoxide dismutase (Mn), mitochondrial1.21
GCE99208.1catalase T2
Ergosterol synthesis
GCE98125.1phosphomevalonate kinase0.64
GCE98064.1diphosphomevalonate decarboxylase0.68
GCE98950.1phospholipid:diacylglycerol acyltransferase0.77
GCF01680.1squalene epoxidase0.8
GCE99731.1erg10, acetyl-CoA C-acetyltransferase1.61
GCE99856.1C-24(28) sterol reductase1.49
GCE99284.1RNA polymerase C-22 sterol desaturase1.52
GCE97050.1farnesyl pyrophosphate synthetase0.66
Cell wall
GCE99669.1UDP-glucose-4-epimerase0.48
GCE98182.1UDP-N-acetylglucosamine pyrophosphorylase0.73
GCE99673.1chitin synthase, class 30.75
GCE99446.1glutamine-fructose-6-phosphate transaminase0.77
GCE99630.1chitin synthase, class 10.82
GCE97781.1Peroxin0.75
NADH generation
GCE97061.1formate dehydrogenase 11.71
GCE97099.1formate dehydrogenase 11.84
GCE98400.1formate dehydrogenase 110
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Xu, X.; Zhu, Y.; Li, Y.; Yang, W.; Zhou, H.; Chen, X. Proteomics Analysis of Zygosaccharomyces mellis in Response to Sugar Stress. Processes 2022, 10, 1193. https://doi.org/10.3390/pr10061193

AMA Style

Xu X, Zhu Y, Li Y, Yang W, Zhou H, Chen X. Proteomics Analysis of Zygosaccharomyces mellis in Response to Sugar Stress. Processes. 2022; 10(6):1193. https://doi.org/10.3390/pr10061193

Chicago/Turabian Style

Xu, Xiaolan, Yuxuan Zhu, Yujie Li, Wenchao Yang, Hao Zhou, and Xinchao Chen. 2022. "Proteomics Analysis of Zygosaccharomyces mellis in Response to Sugar Stress" Processes 10, no. 6: 1193. https://doi.org/10.3390/pr10061193

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop