Journal List > Ann Clin Microbiol > v.17(2) > 1078513

TOOLS
Cho, Nam, Yang, Soh, Kim, and Lee: A Study of Efflux Pump Genes in Mycobacterium tuberculosis Clinical Isolates
Original Article

Ann Clin Microbiol 2014;17(2):65-68.

Published online: 5 June 2014

DOI: https://doi.org/10.5145/ACM.2014.17.2.65

A Study of Efflux Pump Genes in Mycobacterium tuberculosis Clinical Isolates

Sun Young Cho1, You Sun Nam2, Hyung-Seok Yang1, Yun Soo Soh3, Min Jin Kim4, Hee Joo Lee1

1Department of Laboratory Medicine, School of Medicine, Kyung Hee University, Seoul, Korea

2Department of Biomedical Science, Kyung Hee University Graduate School, Seoul, Korea

3Department of Medicine, Kyung Hee University Graduate School, Seoul, Korea

4Seegene Medical Foundation, Seoul, Korea

Correspondence: Hee Joo Lee, Department of Laboratory Medicine, School of Medicine, Kyung Hee University, 1 Hoegi-dong, Dongdaemoon-gu, Seoul 130-702, Korea. (Tel) 82-2-958-8672, (Fax) 82-2-958-8609, (E-mail) leehejo@khmc.or.kr

Received 12 November 201317 April 2014       Accepted 13 May 2014

Copyright © 2014 The Korean Society of Clinical Microbiology

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

초록

The efflux pump system has been suggested as an important mechanism in the drug resistance of Mycobacterium tuberculosis (MTB). In this study, molecular analysis of five genes in the efflux pump system of MTB isolates from Korean patients was performed in order to identify appropriate molecular targets. In this study, 35 culture-positive specimens were included. PCR was performed for five efflux genes, mmpL7, efpA, mmr, p55 and tap-like gene. In the 35 clinical isolates, molecular analysis of five kinds of efflux pump genes was performed. Only one clinical isolate showed negative PCR results for all five efflux pump genes. All the rest 34 isolates presented concurrent positive results for the five efflux pump genes. In the near future, gene expression study with quantitative PCR should be performed using these genes.

Keywords: Multidrug efflux pump genes, Mycobacterium tuberculosis, Drug resistance

REFERENCES

1.Soto SM. Role of efflux pumps in the antibiotic resistance of bacteria embedded in a biofilm. Virulence. 2013. 4:223–9.
crossref
2.Sarathy J., Dartois V., Dick T., Gengenbacher M. Reduced drug uptake in phenotypically resistant nutrient-starved nonreplicating Mycobacterium tuberculosis. Antimicrob Agents Chemother. 2013. 57:1648–53.
3.da Silva PE., Von Groll A., Martin A., Palomino JC. Efflux as a mechanism for drug resistance in Mycobacterium tuberculosis. FEMS Immunol Med Microbiol. 2011. 63:1–9.
4.Balganesh M., Dinesh N., Sharma S., Kuruppath S., Nair AV., Sharma U. Efflux pumps of Mycobacterium tuberculosis play a significant role in antituberculosis activity of potential drug candidates. Antimicrob Agents Chemother. 2012. 56:2643–51.
5.Escribano I., Rodríguez JC., Llorca B., García-Pachon E., Ruiz M., Royo G. Importance of the efflux pump systems in the resistance of Mycobacterium tuberculosis to fluoroquinolones and linezolid. Chemotherapy. 2007. 53:397–401.
6.Schmalstieg AM., Srivastava S., Belkaya S., Deshpande D., Meek C., Leff R, et al. The antibiotic resistance arrow of time: efflux pump induction is a general first step in the evolution of mycobacterial drug resistance. Antimicrob Agents Chemother. 2012. 56:4806–15.
crossref
7.Kim HJ. Current Status of Tuberculosis in Korea. Korean J Med. 2012. 82:257–62.
crossref
8.Rodrigues L., Machado D., Couto I., Amaral L., Viveiros M. Contribution of efflux activity to isoniazid resistance in the Mycobacterium tuberculosis complex. Infect Genet Evol. 2012. 12:695–700.
9.Cho SY., Kim MJ., Suh JT., Lee HJ. Comparison of diagnostic performance of three real-time PCR kits for detecting Mycobacterium species. Yonsei Med J. 2011. 52:301–6.

Fig. 1.
Molecular analysis of efflux pump genes in clinical specimens of Korean patients. In total 35 specimens showing the positivity for M. tuberculosis, only one clinical strain shows negative results in all of 5 kinds of efflux pump gene PCR (specimen serial number 33, arrows). The rest of strains present positive results in 5 efflux pump genes, simultaneously. M, size marker; NC, negative control; PC, positive control.
acm-17-65f1.tif
Table 1.
Primers for molecular analysis in 5 efflux pump genes
Target gene Primer sequence (5'–3') Size of PCR product Transporter family Drug References
A Rv2942 (mmpL7) F) TACCCAAGCTGGAAACAA 214 bp RND INH [3], [9]
R) CCGTCAGAATAGAGGAACAG        
B Rv2846c (efpA) F) ATGGTAATGCCTGACATCC 131 bp MFS INH, ETH [3], [9]
R) CTACGGGAAACCAACAAAG        
C Rv3065 (mmr) F) AACCAGCCTGCTCAAAAG 221 bp SMR INH [9], [10]
R) CAACCACCTTCATCACAGA        
D Rv1410c (p55) F) AGTGGGAAATAAGCCAGTAA 198 bp MFS STR, RIF, INH [3], [9]
R) TGGTTGATGTCGAGCTGT        
E Rv1258c (tap-like gene) F) AGTTATAGATCGGCTGGATG 268 bp MFS STR, RIF, OFX, INH [3], [9]
R) GTGCTGTTCCCGAAATAC        

Abbreviations: F, forward; R, reverse; bp, base pairs; RND, resistance nodulation division; MFS, major facilitator super-family; SMR, small multidrug resistance family; INH, isoniazid; RIF, rifampicin; OFX, ofloxacin.

Table 2.
Characteristics of 35 clinical isolates in this study
No. Specimen Sex/Age AFB smear Culture (L) Culture (S) Drug susceptibility test*
1 Sputum M/37 1+ Negative 1+ Susceptible for all agents tested
2 Sputum M/27 1+ MTB 1+ Susceptible for all agents tested
3 Urine, clean F/69 Negative MTB 2+ Susceptible for all agents tested
4 Sputum M/26 Negative Negative 1+ Susceptible for all agents tested
5 Urine, clean F/73 Negative NA 1+ NA
6 Sputum M/43 2+ Negative 2+ Susceptible for all agents tested
7 Sputum M/52 Negative NA 1+ Susceptible for all agents tested
8 Sputum F/25 3+ NA 2+ Susceptible for all agents tested
9 Pleural mass F/81 Negative MTB 1+ Susceptible for all agents tested
10 Pleural fluid F/46 Negative MTB 1+ Susceptible for all agents tested
11 Sputum F/46 1+ MTB 2+ Susceptible for all agents tested
12 Sputum M/15 Negative MTB 1+ Susceptible for all agents tested
13 Sputum F/25 Negative MTB 1+ NA
14 Sputum F/79 Negative MTB 1+ NA
15 Sputum F/80 Negative Negative 1+ NA
16 Sputum F/79 Negative MTB 1+ Susceptible for all agents tested
17 Sputum M/71 1+ MTB 1+ Susceptible for all agents tested
18 Sputum F/72 Negative MTB 1+ Susceptible for all agents tested
19 Sputum M/32 Negative MTB 1+ Susceptible for all agents tested
20 Sputum F/54 Negative MTB 2+ Susceptible for all agents tested
21 Bronchial washing F/54 Negative MTB 1+ Susceptible for all agents tested
22 Sputum M/81 2+ MTB 1+ Resistant for INH, RIF, and EMB
23 Sputum M/51 1+ Negative 2+ Susceptible for all agents tested
24 Bronchial washing F/69 Negative MTB 1+ Susceptible for all agents tested
25 Sputum M/64 Negative MTB 1+ Susceptible for all agents tested
26 Sputum M/54 1+ MTB 1+ Susceptible for all agents tested
27 Mediastinum F/37 Negative MTB 1+ NA
28 Bronchial washing M/17 Negative MTB 1+ Resistant for SM, RIF, and RFB
29 Bronchial washing M/39 Negative MTB 1+ Susceptible for all agents tested
30 Sputum M/72 Negative Negative 1+ Susceptible for all agents tested
31 Sputum F/72 Negative MTB 1+ Susceptible for all agents tested
32 Sputum F/80 Negative MTB 1+ Susceptible for all agents tested
33 Sputum F/81 Negative MTB 1+ Resistant for INH
34 Sputum F/81 1+ MTB 1+ Resistant for INH
35 Sputum F/27 1+ NA 1+ Susceptible for all agents tested

Abbreviations: L, liquid; S, solid; F, female; M, male; NA, non-available; MTB, Mycobacterium tuberculosis; INH, isoniazid; RIF, rifampicin; EMB, ethambutol; SM, streptomycin; RFB, rifabutin.

∗ Tested anti-TB agents for the drug susceptibility test include amikacin, capreomycin, cycloserin, ethambutol, isoniazid, kanamycin, levofloxacin, moxifloxacin, ofloxacin, P-aminosalicylic acid, prothionamide, pyrazinamide, rifampicin and streptomycin.

TOOLS
Similar articles